Answer:
[D] Pitch
Explanation:
The measure of how high or low a sound is called the pitch.
Plants convert the sun's energy into carbohydrates via photosynthesis.
Answer:
Phytoplankton are essential for atmospheric and climate regulation.
Explanation:
Phytoplankton are autotrophs, they use solar energy, along with inorganic carbon and water to produce their own food source via photosynthesis. During photosynthesis, they also produce oxygen, integral for the planet's atmospheric composition.
At their large biomass, phytoplankton contribute to a majority of the oxygen used by consumers (most animals).
6 CO2 + 6 H2O + light → C6H12O6 + 6 O2
Carbon Dioxide + Water + Light Glucose + Oxygen
Along with fossil fuels, human agricultural practices have contributed large amounts of CO2 to the atmosphere, This causes global warming, a major environmental crisis- global warming also leads to landmass loss, biosphere disruption and reduces biodiversity in mass extinction events.
Phytoplankton carbon cycling produces organic matter which functions as carbon sinks in our oceans. Thus, as phytoplankton use large amounts of CO2, they help combat warming cycles, along with producing O2 in atmospheric and climate regulation.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved