1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
3 years ago
7

A group of scientists is studying the internal parts of a cell. Which microscope is most appropriate for these scientists to use

?
a. simple
b. electron
c. light
d. compound
Biology
2 answers:
svetlana [45]3 years ago
7 0
If a group of scientists are studying the internal parts of a cell, the microscope which is most appropriate for these scientists to use is the electron. The correct answer is B.<span />
Lady bird [3.3K]3 years ago
4 0
The most appropriate microscope for studying the internal parts of the cell is ELECTRON MICROSCOPE. The correct option is B.
Electron microscope, which is a compound microscope is usually used to study the internal environment  of the cell because of the easiness with which one can easily distinguish the cell organelles from one another. Electron microscope gives great clarification of the cellular components and allow scientists to observe minute details about cellular structures. Electron microscope usually magnify specimens to one million times of their real sizes. 
You might be interested in
21) What is the measure of how high or how low a wave sounds?
OLga [1]

Answer:

[D] Pitch

Explanation:

The measure of how high or low a sound is called the pitch.

6 0
2 years ago
The ability not to taste PTC is dependent on recessive gene (t).
yKpoI14uk [10]
Would say it would be a
3 0
3 years ago
You run on solar energy. How is that possible?
scoray [572]
Plants convert the sun's energy into carbohydrates via photosynthesis.
7 0
3 years ago
Disscus the importance of phytoplankton to the composition of the earth's atmosphere?​
Evgesh-ka [11]

Answer:

Phytoplankton are essential for atmospheric and climate regulation.

Explanation:

Phytoplankton are autotrophs, they use solar energy, along with inorganic carbon and water to produce their own food source via photosynthesis. During photosynthesis, they also produce oxygen, integral for the planet's atmospheric composition.

At their large biomass, phytoplankton contribute to a majority of the oxygen used by consumers (most animals).

             6 CO2 + 6 H2O + light  →  C6H12O6 + 6 O2

Carbon Dioxide + Water + Light       Glucose + Oxygen

Along with fossil fuels, human agricultural practices have contributed large amounts of CO2 to the atmosphere, This causes global warming, a major environmental crisis- global warming also leads to landmass loss, biosphere disruption and reduces biodiversity in mass extinction events.

Phytoplankton carbon cycling produces organic matter which functions as carbon sinks in our oceans. Thus, as phytoplankton use large amounts of CO2, they help combat warming cycles, along with producing O2 in atmospheric and climate regulation.

6 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Write an analogy to explain why cell size is limited
    15·1 answer
  • Consider the model for natural selection. Describe a scenario that represents this model of natural selection.
    11·2 answers
  • Use the drop-down menu to answer each question.
    11·2 answers
  • List 3 pieces of information you would find on a periodic table or elements
    11·1 answer
  • What components does the chemical level include
    11·2 answers
  • PLEASE ANSWER ASAP
    5·1 answer
  • Explanation for how a wildfire affects resources and populations in a forest ecosystem.
    7·1 answer
  • Analyze the graph and identify some factors that may contribute to the rotifer population leveling off in the absence of water f
    8·1 answer
  • Which is the best explanation for how earthquakes cause tsunamis?.
    14·2 answers
  • What is spermatogenesis and sporophyte?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!