1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina CMI [18]
3 years ago
11

A student has obtained a sample of pond water for study. Using the high-power lens, he observes several cells with nuclei. He ca

n conclude that the cells are NOT bacteria.
True/False
Biology
1 answer:
Reil [10]3 years ago
7 0

Answer:

True

Explanation:

Bacteria are prokaryotic organisms. Being prokaryotes, bacteria do not have a nucleus in their cells. Their DNA or the genetic material lies in the cytoplasm itself. Therefore, if the observed cells have a nucleus and other membrane-bound organelles, this means that those cells were not the bacterial cells. Bacterial cells also do not have other membrane-bound organelles such as mitochondria, endoplasmic reticulum, etc.

You might be interested in
Identify the functions of the brain.
alexdok [17]

Answer:

1) thalamus

2) cerebrum

3) hypothalamus

Hope this helps

5 0
3 years ago
Read 2 more answers
In your own words, can you explain where a hot<br> spot can be found AND what does it looks like?
Blababa [14]

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

4 0
3 years ago
How does mitosis differ from spermatogenesis and oogenesis ?
Snowcat [4.5K]

Answer:

Spermatogenesis:Onespermatocyteproducesfourspermatozoa. Oogenesis:Oneoocyteproducesonlyoneovum. Spermatogenesis:Spermsaresmallerthanspermatocyte. Oogenesis:Ovumislargerthantheoocyte

Explanation:

3 0
3 years ago
Which level on the energy pyramid has the third most energy?
Elenna [48]
The correct answer is D,
dose this help?
8 0
3 years ago
How do you micro-habitat and various biomes support different organisms
Ksenya-84 [330]

➢

  • microhabitat. ...
  • Microhabitats promote biodiversity because they create more niches for organisms to adapt to. ...
  • The number of organisms an ecosystem can support depends on the resources available and abiotic factors, such as quantity of light and water, range of temperatures, and soil composition.

#CarryOnLearning

6 0
2 years ago
Read 2 more answers
Other questions:
  • Which scientific skill involves sharing what you have learned with others?
    12·2 answers
  • How does the declination of the sun vary over 1 yr?<br><br> Checking answers for my lab.
    12·2 answers
  • Draw conclusions: Natural selectionis the process by which favorable traits tend to increase in frequency over time. How does th
    11·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • LDL (low-density lipoprotein) contains
    15·1 answer
  • If a gene contains 396 bases, how many amino acids will be needed to build a resulting protein. Explain.
    11·1 answer
  • ⁉️‼️NEED answer ASAP‼️⁉️The pH of a solution is 7. Which best describes a solution? Solution has more hydrogen ions and hydroxi
    7·2 answers
  • Select all the correct answers.
    10·1 answer
  • What are the relevance of biolgical practice related to healthcare​
    10·1 answer
  • How does the slope of land or direction of<br> plowing affect how water runs over the land?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!