1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erica [24]
3 years ago
5

Describe pathogens, give examples, explain how pathogens make us sick

Biology
1 answer:
larisa86 [58]3 years ago
3 0
I will help you best I can!

Pathogens are the bacteria and germs that cause the immune system to be weakened. They make us sick because out body sometimes cross paths with germy critters we aren't used to and our immune system isn't capable of fighting them. Hint some people have strong immune systems and get sick less compared to those who have a weak one. An Example would be when someone sneezes and the droplets from their sneeze spread in the air and come into contact with another person, also causing them to become sick. This is how pathogens spread through indirect and direct contact..
You might be interested in
How long and how frequently should cold be applied to the injured area during the first 24 to 48 hours?
katrin [286]
Ice should be applied within the first 5-10 minutes after getting the injury and leave the ice for 20-30 minutes. This can be repeated every 2-3 hours or so for the next 24-48 hours.
If you consider the first 48 hours, and this timings, the frequency should be between 16 to 24 times. If you consider 24 hours, it should be between 8 and 12 times.
7 0
3 years ago
Which of the following types of algae is unicellular?
Andrews [41]

Answer: green algae

Explanation:

Alga is classified as plants as it contains chlorophyll. But, it lacks true stem, roots etc.  It is a large group of aquatic plants.  Algae could be unicellular, multi cellular or colonial.  

A unicellular contains single cell where as multi-cellular consists of of many cells. Kelp, Plankton and Brown algae are multi-cellular where as green algae can be either unicellular or multi-cellular.

3 0
3 years ago
Read 2 more answers
Following their sixteen-week, closed-ended, grief and loss psychotherapy group with adults as reported by Price et al, which of
tankabanditka [31]

Answer:

Option B

Explanation:

Complete question -

Following their sixteen-week, closed-ended, grief and loss psychotherapy group with adults as reported by Price et al, which of Yalom's therapeutic factors was most identifiable?

a. recapitulation

b. altruism

c. universality

d. imagery

Solutions -

Out of the eleven therapeutic factors the one that will be easily recognizable will be the one which will involve some kind of action and interaction or any visible signs. Altruism would affect a person positively and help him/her to gain confidence. This confidence will be visible by the person’s action when he/she will help other people in the group to gain value and significance in the same way as he/she has done.  

Hence, option B is correct

3 0
3 years ago
When researching your topic which sources of information should you avoid?
Alekssandra [29.7K]

Answer:

No alrighfull information like Wikipedia, or .com or .net because they earn money from it so not fully

Explanation:

8 0
2 years ago
1. Describe the different methods of asexual reproduction. Give examples.
igor_vitrenko [27]

Explanation:

Code : 257 403 0731

Pass :HELLO

zoom

6 0
3 years ago
Other questions:
  • What is iodine solution changing from amber-yellow to blue-black an indication of?
    6·2 answers
  • Topographic highs that separate drainage basins are called ____.
    14·1 answer
  • Why was it important to record the pH of the seawater sample before blowing into it
    10·1 answer
  • The ions in a compound form and orderly three-dimensional arrangement called a molecule. true or false
    13·1 answer
  • People with a mutation in the gene encoding the enzyme hexosaminidase a have the disease ________________. these people suffer f
    11·1 answer
  • Glycolysis converts glucose into two molecules of _____.
    10·2 answers
  • As the amount of water vapor in the air increases,
    9·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • B. Write five (5) ways on how to conserve water.Write your answers on a separate of paper.
    11·1 answer
  • Which portions of the large intestine are located in the pelvic cavity?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!