Answer:
Option D
Explanation:
Complete question
which of the following properties of water are essential for life on Earth?
A) polarity
B) Cohesion & Adhesion
C) High heat capacity
D) All the above
Solution
Some essential properties of water are as follows –
a) Polarity
b) Solvent
c) High heat capacity - it is essential to maintain the temperature on earth. The water bodies are comparatively cooler than the temperature of earth
d) High heat of vaporization
e) Cohesion – It is essential for surface tension & capillary action
f) Adhesion – It is essential for surface tension & capillary action
g) Lower freezing density – Due to this reason, ice is lighter than water
Hence, option D is correct
Answer:
Car pollutants cause immediate and long-term effects on the environment.
Explanation:
Car exhausts emit a wide range of gases and solid matter, causing global warming, acid rain, and harming the environment and the health of living organisms, like humans.
Long-term exposure to polluted air can have permanent health effects such as:
- Accelerated aging of the lungs.
- Loss of lung capacity and decreased lung function.
- Development of diseases such as asthma, bronchitis, emphysema, and possibly cancer.
Hope it helps answer the question:)
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
When the starfish were removed from the area as part of an experiment, the mussel population swelled and crowded out other species. The biodiversity of the ecosystem was drastically reduced. Payne's study showed that identifying and protecting keystone species can help preserve the population of many other species.
