1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
4 years ago
13

As scientists began to learn more about geologic time, they incorporated their findings into systems of classification. What is

the system that takes into account an organism’s evolutionary history?
Biology
1 answer:
Volgvan4 years ago
7 0

Answer:

Answer is phylogeny.

Explanation:

Phylogeny is a term used in evolution.

It involves the study to understand the evolutionary history of a particular group or species of organisms, which will help in naming and classifying them.

You might be interested in
Easy question, easy points​
Lapatulllka [165]

Answer:

I believe it's C.

Explanation:

7 0
3 years ago
Which of the following properties of water are essential for life on Earth?​
Viktor [21]

Answer:

Option D

Explanation:

Complete question

which of the following properties of water are essential for life on Earth?​

A) polarity

B) Cohesion & Adhesion

C) High heat capacity

D) All the above

Solution

Some essential properties of water are as follows –  

a) Polarity

b) Solvent

c) High heat capacity - it is essential to maintain the temperature on earth. The water bodies are comparatively cooler than the temperature of earth

d) High heat of vaporization

e) Cohesion – It is essential for surface tension & capillary action

f) Adhesion – It is essential for surface tension & capillary action

g) Lower freezing density – Due to this reason, ice is lighter than water

Hence, option D is correct

7 0
3 years ago
How is a car polluting the earth and making us sick
denis23 [38]

Answer:

Car pollutants cause immediate and long-term effects on the environment.

Explanation:

Car exhausts emit a wide range of gases and solid matter, causing global warming, acid rain, and harming the environment and the health of living organisms, like humans.

Long-term exposure to polluted air can have permanent health effects such as:

  • Accelerated aging of the lungs.
  • Loss of lung capacity and decreased lung function.
  • Development of diseases such as asthma, bronchitis, emphysema, and possibly cancer.

Hope it helps answer the question:)

5 0
3 years ago
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
• How removal of starfish from an aquatic environment/ocean will affect the biodiversity?
klemol [59]
When the starfish were removed from the area as part of an experiment, the mussel population swelled and crowded out other species. The biodiversity of the ecosystem was drastically reduced. Payne's study showed that identifying and protecting keystone species can help preserve the population of many other species.
7 0
3 years ago
Other questions:
  • The brain has very limited ability to repair or reorganize itself after injury or damage. true false
    13·1 answer
  • How old do scientists believe that Earth is?
    15·1 answer
  • In a study of identical twins by the National Institute of Mental Health, when one twin had schizophrenia and the other did not,
    15·1 answer
  • Which is a part of the cell theory?
    15·2 answers
  • One of the unique characteristics of hinduism is that it
    10·1 answer
  • South Africa once (colder/warmer) than it is today.
    13·1 answer
  • What happens if enzymes aren’t in the digestive system?
    13·2 answers
  • Genetically engineered pork has a higher flesh-to-bone ratio. Which of the following sentences explains how pork is genetically
    13·1 answer
  • In what stage of Meiosis does crossing-over happen?
    5·2 answers
  • Living things can weather rocks by both mechanical and chemical means. true or false
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!