1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
6

PLEASSEE HELP I WILL GIVE 20 POINTS no wrong answers pllzz

Biology
2 answers:
finlep [7]3 years ago
7 0

The given temperature of T=50 ∘C and the given pressure of p=92.5 mmHg approximately correspond to equilibrium conditions for liquid water and steam. (Strictly speaking, the corresponding saturation pressure for a given temperature of T=50.000 ∘C is p=92.647 mmHg, which could be rounded to p=92.6 mmHg and not p=92.5 mmHg; in the opposite direction, however, the corresponding saturation temperature for a given pressure of p=92.500 mmHg is T=49.968 ∘C, which could be rounded to T=50 ∘C.) The question does not explain whether these values describe the initial or final state; however, since the values correspond to equilibrium conditions, we may assume that these values apply to the final state when equilibrium is established (e.g. this can be achieved by keeping the closed system at a constant temperature of T=50 ∘C). Strictly speaking, the question doesn’t even explain whether the added water initially is liquid or steam; however, this is not relevant for the final state. If the water is added as liquid, a part of it evaporates until the equilibrium state is reached in the closed container; if the water is introduced as steam, a part of it condenses until the equilibrium state is reached. Therefore, when the defined equilibrium is established, the container contains certain amounts of liquid water and steam irrespective of the initial conditions. The question does not mention any air in the container. For simplicity’s sake, we may assume that the container has been evacuated before the experiment and contains only liquid water and vapour. The available volume of the container is reduced by the volume of the liquid water. However, since the density of liquid water at the given temperature and pressure is about ρ=988 kg m−3, the given mass of m=1.00 g corresponds to a maximum volume of Vliquid=1.01 ml=0.00101 l, assuming that no water has evaporated. Considering that the total volume is given as V=5.00 l (note the number of significant digits), the difference caused by the liquid water is not significant and may be neglected. Note that the use of the non-SI unit “conventional millimetre of mercury” (unit symbol: mmHg) is deprecated; the use of SI units is to be preferred.

Inessa05 [86]3 years ago
5 0

A. 13.5 grams is the answer.

You might be interested in
Adenosine triphosphate (ATP), is often referred to as the energy currency of the cell. Wich of the following cellular processes
klasskru [66]

Answer:

4

Explanation:

3 0
3 years ago
Which of the following is the correct sequence in which a DNA sequence is used to produce a protein?
mrs_skeptik [129]
C of course
C is the answer
4 0
2 years ago
What was the main environmental issue in this case?
MAXImum [283]
Zit sure has to be B. Pollution
4 0
3 years ago
Complete the phylogenetic tree by matching each characteristic that arose during the evolution of animals to its correct positio
spayn [35]

Answer:

The correct characteristics are -<em><u> tissue, coelom, segmentation, endoskeleton, and backbone</u></em> from top to bottom boxes.

Explanation:

This phylogenetic tree showing the evolution and relatedness of the different organisms on their shared characteristics. In the given phylogenetic tree there are some characters are missing and we can predict or state them on the basis of evolution and studying the characteristics.

After the Porifera phylum tissue-level organization is found in the organism hence Tissue would be placed in the first box.

The coelom is found organisms above the Nematoda level, which further include a character segmentation in Annelida and Arthropoda. Another lineage from arising with the coelom organism that included endoskelton and backbone.

Thus, The correct characteristics are - tissue, coelom, segmentation, endoskeleton, and backbone from top to bottom boxes.

3 0
3 years ago
A student wants to perform an experiment to test the effect of different colored lights on the growth of basil plants. She sets
Elena-2011 [213]

Answer:

light is the independent variable, height of the plant is the dependent variable. Dependent is the effect that based on the independent.

Explanation:

lets break it down. 1) you want to know the effect of something you apply from one thing to another. Let say, if you grow your plants under the sunlight, the plants grow taller. In this case, the sunshine is the independent variable whereas the height of the plant/how tall it can grow is the dependent variable. 2)NOW, before i give the answer. The design of the question is not good for high school students. i think your teacher thinks "light" is the independent variable. 3)However, the question contains confounding variables in it because different lights might produce different effects to the height of the plants. If you want to test if plants are exposed to light grows taller than plants do not expose to light, then you should have all the lights are the same. 4) So, all the plants should be exposed to one certain light to avoid confounding. Confounding means that either red light and sunlight are both produce the same effect whereas the other colors do not help the plants to grow taller. 5)Your teacher should test one light at a time. So, if he is testing with all different colors of light, then light is the independent variable, and height of the plant is the dependent variable.

4 0
3 years ago
Other questions:
  • Which of the following statements are true about genetic engineering?
    10·2 answers
  • Analysis of the term chondralgia, which means painful cartilage, reveals the presence of which word parts?
    11·2 answers
  • Don has a family history of high blood pressure. How can Don's family history impact his health?
    13·1 answer
  • Explain ATP in detail
    15·2 answers
  • Classify the following organisms into their respective kingdoms (i) Yeast (ii) Penicillium (iii) Rhizobium (iv) Mushroom (v) Amo
    10·1 answer
  • What adaptation most likely helps this bird fly?
    8·2 answers
  • Choose three nutrients and explain how a plant may look if it has a deficiency in those nutrients.
    15·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • 3<br> Comment appelle-t-on les cellules sexuelles ?
    10·1 answer
  • What moon phase has light on the left and the lit portion is less than half?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!