1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kow [346]
3 years ago
14

The autonomic nervous system regulates the action of the

Biology
1 answer:
Deffense [45]3 years ago
5 0
<span> involuntary muscles and organs is your answer </span>
You might be interested in
In fermentation, which step of cellular respiration is being accomplished?
Annette [7]
The process that occurs in a cell when there is not enough oxygen is called fermentation. Fermentation occurs through the process of Anaerobic Respiration, where instead of using oxygen, organic and inorganic molecules are used as final electron acceptors. The by-product of this process is usually alcohol, ethanol, or acetic acids.
<span>
Fermentation is commonly used in lactic acid (in muscles) and alcohol (beers, whiskey) fermentation where the by-product is ethanol. Yeasts are a common organism that uses this process, where it convert sugars into alcohols or acetic acids.</span>
7 0
3 years ago
Which of the following is most likely to cause increases in a predator population?
Ksivusya [100]
1. B A reduction in competition. 2. C. Respiratory system
4 0
3 years ago
The location of the water table is subject to change. Please select the best answer from the choices provided T F
Darya [45]
True because the surface of the water table may vary due to seasonal change
4 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
What tissue contains large amounts of fluid and transports nutrients wastes and gases?
Elza [17]

Blood is the connective tissue that contains large amounts of fluid and transports nutrients wastes and gases.

Blood is considered a connective tissue as it has the same origin as other connective tissues like cartilage and bone cells. Blood also connects the whole body together and transports the needed oxygen, hormones, other nutrients and blood throughout the body and also expels out wastes.

4 0
3 years ago
Other questions:
  • Suppose you find a rock with a goniatite fossil and another rock with an ammonite fossil? Which rock is older? How do you know?
    9·1 answer
  • Dogs and cats are animals that have many similar body structures but they do not mate with each other. These two animals are cla
    7·1 answer
  • What are selective pressure?(define not example)
    10·1 answer
  • What is the result of inbreeding over generations?
    14·1 answer
  • Help, please! When there is an imbalance in a body system, and the body cannot maintain homeostasis, how might other systems res
    9·1 answer
  • Describe the lytic cycle.
    14·1 answer
  • C4 plants occur more commonly in desert conditions because _____.
    7·1 answer
  • After asking a question what does a scientist form that can be proved or disproved by an explanation
    12·2 answers
  • dos semejanzas y tres diferencias, entre los postulados griegos, y los postulados de Van Helmont y Needham de las teorías abioge
    7·1 answer
  • Bacteria reproduce by injecting their genes into other cells. Please select the best answer from the choices provided. T F.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!