1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
9

Before starch can enter a cell it must be

Biology
1 answer:
vazorg [7]3 years ago
8 0
Before starch can enter a cell it must be digested
You might be interested in
Geysers are eruptions of hot water from the ground. Geysers are usually found in areas of volcanic activity. The heat required t
Monica [59]

Answer:

mantle

Explanation:

The mantle has lava, and lava is hot. When lava gets close to water, it heats it.

8 0
3 years ago
Which of the following would you predict would evolve in guppies taken from streams with predators that key in on prey color and
yKpoI14uk [10]

Answer:

Guppies would become more colorful.

Explanation:

7 0
4 years ago
At the end of meiosis I each cell has __________ the number of chromosomes as was in the original cell.
goldfiish [28.3K]
A. At the end of meiosis I each cell has twice the number of chromosomes as was in the original cell.
4 0
3 years ago
A transcriptional repressor that controls the transcription of gene A is not normally active unless bound by an effector molecul
iren [92.7K]

Answer:

Increase in transcription

Explanation:

Transcription is the process of forming RNA from DNA. It can be controlled by many factors like a repressor. Repressor can bind to the operator region of the promoter and hinder the movement of RNA Polymerase enzyme, halting the process.

Here, it is given that the repressor needs to first bind to an effector molecule X. Once it binds to X, it is activated and then it can bind to operator of gene A to inhibit its transcription. If the X binding domain on repressor is mutated it wont be able to bind to X. Thus it wont get activated and wont be able to attach to operator region to inhibit transcription. Hence, transcription process will keep going on uncontrolled.

5 0
4 years ago
Development refers to the increase in size of an individual<br><br> true <br> false
nlexa [21]

Answer: true

Explanation: Growth refers to change in size, like weight or length. Development refers to changes in physical, social, emotional, and intellectual abilities.

7 0
2 years ago
Read 2 more answers
Other questions:
  • What's the difference between physical and chemical properties
    12·1 answer
  • which of the following would not be considered a point source pollution contributor a. an animal feed lot b. cattle on rangeland
    10·1 answer
  • Why do some people worry that eating genetically modified food may be harmful?
    12·2 answers
  • Positive correlations have been found between ____ and health outcomes.
    11·2 answers
  • How do scientists separate the layers of the atmosphere
    6·1 answer
  • Do you think anything happened to the carrying capacity of the area from 1900 to 1940
    15·1 answer
  • What molecule synthesized by plants is a major source of energy for cellular processes in both plants and animals
    9·1 answer
  • In your own words what is the definition for Mineral (include why they are important to enzymes and what this relationship is ca
    8·1 answer
  • Which term best describes any organism that lives on or in another living organism and takes nutrients from that organism withou
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!