All categories

3 years ago

What were the British weakness in the revolutionary war?

Biology

2 answers:

Nesterboy [21]3 years ago

7 0

Answer:

One of the weakness' they had were "distant lands". They had to ship goods across the Atlantic which became costly. Not only that, but it also took several months to arrive.

Rudik [331]3 years ago

4 0

Answer:

They were fighting in distant land. Some of the supplies they needed to fight weren't there so this made it hard for them to fight. It took sometimes even months just to get it to them, hope this helped!

You might be interested in

Which of the following describes the role that enzymes play in the process of metabolism?

Alja [10]

D. Enzymes increase the rate of the chemical reactions carried out during metabolism.

5 0

3 years ago

Read 2 more answers

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

What is meant by the overload principle? what is meant by the overload principle? stretching a muscle group beyond the joint's h

valentinak56 [21]

This principle, or thought process, is that in basic sports fitness programs, all athletes training to continuously improve must always work harder an harder as their bodies become more used to their existing work out routines.

3 0

3 years ago

Which product is the result of mitosis?

Harlamova29_29 [7]

Answer:

Pretty sure that its C im really sorry if I'm wrong

4 0

3 years ago

Anna hits a golf ball, and it soars through the air toward the green. It travels in an arc across the ground. Which statement do

vladimir2022 [97]

Answer:

Explanation:

7 0

3 years ago