1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
3 years ago
14

how is mitosis different in plants and animals A. in plants, a new cell wall forms to split the cell B. in plants , the DNA is n

ot duplicated C. in animals there is no g0 phase or g2 phase D. in animals the DNA is one circular chromosome
Biology
2 answers:
vesna_86 [32]3 years ago
4 0

Answer:

A. In plants, a new cell wall forms to split the cell

Explanation:

In animal cells, they don't have a cell wall. During mitosis, they just split the cell membrane in order to create 2 new cells. In plant cells, they have cell walls. During mitosis, they create a new cell wall and place it in-between the 2 cells to create 2 new cells.

QB19
2 years ago
YESSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSs
Verdich [7]3 years ago
4 0

Answer:

The correct answer is A. in plants, a new cell wall forms to split the cell

Hope this helped! :)

QB19
2 years ago
yes
QB19
2 years ago
yes
You might be interested in
cross a mom with no hitchhicker thumbs with a dad with hitch hiker thumbs complete the punnet square and detirmine the genetype
dimaraw [331]

no  asria decir la rsepuset al siobntoe

3 0
3 years ago
___ carry motor commands from the brain along the spinal cord.
kipiarov [429]

Answer:

descending tracts is the correct answer.

Explanation:

5 0
3 years ago
Please select the word from the list that best fits the definition
Harrizon [31]

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

4 0
3 years ago
Suppose you are studying coyotes and wolves, and you determine that wolves are experiencing a reduction in their population that
PolarNik [594]
<span>If one determines that wolves are experiencing a reduction in their population that can be attributed to a virus the coyotes carry that is more harmful in wolves. this is an example of apparent competition.</span>
4 0
3 years ago
Which of these best fits the box labeled A?
jeyben [28]
C is the answer I just check it on mine
4 0
3 years ago
Other questions:
  • Which experiments led to changes to the original cell theory?
    5·1 answer
  • Which nutrient supplies the medium in which chemical changes in the body occur?
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following best explains the importance of water to humans?
    7·2 answers
  • Which of these is a pure substance . dimond . salt . ocean water a. a and b. b and c
    10·2 answers
  • The restriction enzymes of bacteria protect the bacteria from successful attack by bacteriophages, whose genomes can be degraded
    7·1 answer
  • Explain why it is important to use only one independent variable at a time in a given investigation.
    11·1 answer
  • PLEASE HELP DUE TODAY!!
    11·1 answer
  • Describe the role of cellular respiration in a plant???
    6·1 answer
  • How did Wallace's ideas about evolution influence Darwin? ​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!