1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
4 years ago
7

Can anyone help? PLEASE

Biology
1 answer:
vredina [299]4 years ago
6 0
Uneven heating of the Earth
You might be interested in
The diagram below shows the chemical structure of a type of lipid molecule called a phospholipid.
SVEN [57.7K]

Answer No 1:

Phospholipids are made up of phosphorus head and two fatty acid molecules.  These phosphorus head and fatty acid tail is joined together by glycerol. Fatty acid molecules are made up of Carbon, hydrogen and oxyge. Hence,carbon and hydrogen can be said as two other elements present in phospholipids.

Answer No 2:

The building blocks of lipids are glycerol and fatty acids.

Lipids can be described as vital organic molecules which are not soluble in water. They are made up of chains of carbon, hydrogen and oxygen. Someof the examples of lipids are fats and oils. Lipids are the main molecules present in an organisms cell membrane and hence have huge biological importance.

Answer No 3:

Lipids are biologically important molecules as they play very vital roles in the functioning of an organisms body. Two of the functions of lipids are:

  • Lipids and phosphorus molecules combine to form phospholipids. The phospholipids are the main molecules out of which the cell membrane is made. Hence, lipids play an essential role in providing the cell membrane its structure.
  • Lipids store energy and provide insulation to the body of an organism.
6 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
When does consumption begin to surpass supply?
11111nata11111 [884]

Answer:

625 years

Explanation:

4 0
3 years ago
Please identify <br> Label A<br> Label B<br> Label C<br> Label D
timurjin [86]

Answer:

Label A: Nucleus

Nucleus can be described as the organelle in which the DNA is enclosed. The nucleus is found in every eukaryotic cell.

Label B: Vacuole

Vacuole can be described as an organelle which is used to store material such as waste. Hence, vacuole is known to be the storage house of a cell.

Label C: Ribosomes

Ribosomes can be described as structures which are present usually on the rough endoplasmic reticulum. The process of translation occurs in the ribosomes and they are hence known to be the protein manufacturing units if a cell.

Label D: Centrioles

A centriole is a cylindrical organelle which is usually made up of the protein tubulin.

6 0
3 years ago
Read 2 more answers
What condition is required for fermentation to occur? A. When oxygen levels within a cell are too low for aerobic respiration B.
Leokris [45]

Answer:

A. When oxygen levels within a cell are too low for aerobic respiration

Explanation:

Fermentation is a chemical or metabolic process that occurs in organism, when a carbohydrate such as glucose is metabolized or converted to an alcohol anaerobically (absence of oxygen).

When an organism lacks oxygen within the cell, aerobic respiration would be halted, hence pyruvate produced from glucose further undergoes fermentation anaerobically.

Organisms like lactic acid bacteria and yeast carry out fermentation. The process of fermentation is widely used in food industries, such as in brewing of wine or manufacture of yogurt.

6 0
3 years ago
Other questions:
  • When is the lac operon most active?
    14·1 answer
  • Which unit is more useful to measure in. Milliliters or liters and why?
    13·1 answer
  • What problem is caused by maps being two-dimensional
    11·1 answer
  • Which color in the visible spectrum did you hypothesize would cause the most plant growth?
    10·1 answer
  • Griffith's experiments with s. pneumoniae were significant because they showed that traits could be transferred from one organis
    8·1 answer
  • ____ is the theory that living organisms are composed of organic compounds that contain a vital force that is not present in non
    9·1 answer
  • The peripheral nervous system (PNS) transmits information to and from the central nervous system (CNS) and plays a role in regul
    7·1 answer
  • Name:<br> Name:<br> 1.<br> Which of the following structures is not found in<br> bacteria?
    13·1 answer
  • Who painted the image above?
    10·1 answer
  • Describe the unique intercellular connections between muscle cell
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!