1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
10

What controls the way cells function?

Biology
2 answers:
kogti [31]3 years ago
8 0

Answer:

Dexoyribonucleic Acid, or DNA, controls the way cells function. It also determines what type of specialized cells will be made. Stem cells are cells that have the ability to become any type of specialized cell in the body.

Explanation:

BIDEN 2020

FrozenT [24]3 years ago
5 0

Answer:

nucleus.

Explanation:

i hope i was able to help

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Why do you think certain laundary detergents contain starch
nirvana33 [79]
Hello user

Question: <span>Why do you think certain laundry detergents contain starch

Answer: Starch is used to clean things some don't contain it because some people believe it is harmful and are allergic to it.

I hope I helped
-Chris</span><span />
3 0
3 years ago
Some plants release toxic chemicals that kill or harm nearby plants. What type of example is this?
ivanzaharov [21]
Your answer would be C: Competition! 

6 0
3 years ago
Read 2 more answers
Do you think the unknown was a plant or animal cell
aev [14]

Need more information to answer the question.

3 0
3 years ago
Describe all the ways in which the human arm and the cat’s front leg are similar.
dmitriy555 [2]

Answer:

a cat's leg, and a human arm are considered homologous structures.

Explanation:

same joints

muscles are in the same places

4 0
3 years ago
Read 2 more answers
Other questions:
  • After population growth, what does the United Nations believe will be the greatest future global pattern?
    12·2 answers
  • PLEASE HELP ASAP!! 70 POINTS!!
    9·2 answers
  • Which of the following is not a way Science influence society
    14·1 answer
  • One purpose of sports drinks is to replace fluid and electrolytes that are lost through sweating.
    11·2 answers
  • Someone please answer these for me:) :
    9·1 answer
  • Microorganisms and humus have little impact on soil health. true or false
    5·2 answers
  • How many years ago did the earth cool enough for solid rocks to form ?
    13·1 answer
  • Cells in many-celled organisms...
    8·2 answers
  • In diffusion, molecules move from ___ to ___ areas of concentration.
    7·2 answers
  • Can we create effective vaccines or immunizations for lab made viruses? Or is it not possible because of the synthetic/man-made
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!