1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
7

In which section of the nephron does the filtrate have a higher osmolarity than the blood when it enters and lower osmolarity th

an the blood when it leaves?
Biology
1 answer:
Liula [17]3 years ago
7 0
I believe it is the ascending loop of henle. In the ascending portion, the loop becomes impermeable to water and instead the cells of the loop, actively reabsorb the solute; thus water is not reabsorbed but ions are readily reabsorbed. As the ions are reabsorbed the concentration becomes more and more hypotonic until it reaches 100-150 mOsm/L. Therefore, the ascending loop is called the diluting segment of the nephron due to its ability to dilute the fluid in the loop from 1200 to 100 mOsm/L.
You might be interested in
When replenishing fluids with a glucose solution, what percentage of glucose and electrolytes is most useful?
Afina-wow [57]

Answer:

6%.

Explanation:

Intravenous glucose solution contains a mixture of glucose especially dextrose and water is used for medicinal purpose. The water loss that occur during fever or any disease can be treated by the glucose solution.

Different glucose level that can be used for the treatment is 5% to 6%, 105 and 0.45 %. The administration of 5 to 6 % sugar solution maintains the balance between hyper glycemia and hypoglycemia. These reactions are activated by sympathetic division that maintains the electrolyte balance in the body.

Thus, the answer is 6%.

6 0
3 years ago
How much guanine is in a salmon
USPshnik [31]

Answer:

It should be 22% (correct me if I'm wrong)

Explanation:

In the DNA of salmon there is 28% Adenine, and 28% Thymine. So the rest 44% of that will be Guanine and Cytosine. (Guanine pairs only with Cytosine) Therefore, Guanine and Cytosine will have same percentage, which will be 22% each in the DNA of salmon. And then Guanine and Cytosine together is 44%, like I already mentioned. So Guanine alone has 22%.

8 0
3 years ago
In sedimentary rock the oldest fossils would be expected to be found
irakobra [83]
Fossils are primarily found in sedimentary rock because these rocks form at low temperature and pressures.
6 0
3 years ago
Valence is the number of electrons an atom must gain or lose in order to _____ its outer energy level or have a stable octet in
sdas [7]
The correct answer is complete.

<span>Valence is the number of electrons an atom must gain or lose in order to complete its outer energy level or have a stable octet in its outer shell. In the first energy level it can have only 2, but later levels can have 8, that is, an octet.</span>

6 0
3 years ago
Read 2 more answers
The study of nutrients in food and in the body is referred to as nutrition and is sometimes called the study of human behaviors.
zhenek [66]

Answer: False

Explanation:

Nutrition is the study of nutrients in food and it's impact on body. Nutrition can be defined as the consumption of nutritive food that provide energy to the body. Nutrition can be gain from nutrients found in vegetable, fruits, and other   non-vegetable sources.

Whereas, Human behavior is the study of human behavior that depends on sociology, psychology, anthropology, and economics. Human behavior is the basis of differentiation between lives of human that based on their  behavioral study.

Hence, the given statement if wrong as the study of nutrients and the study of human behaviors are two different things.

4 0
3 years ago
Other questions:
  • A researcher discovers a new unicellular organism that contains a single circular chromosome and no membrane-bound organelles. U
    13·1 answer
  • Produce oxygen that we need to live.
    10·1 answer
  • There are many traits for which it seems natural selection should favor an increase every generation, such as survival from birt
    14·1 answer
  • The ability for an enzyme to pick out one particular substrate from the myriad of molecules floating around its environment is a
    8·1 answer
  • How do mitosis and meiosis differ in the division of genetic composition?
    6·1 answer
  • The Global Youth Tobacco Survey asks youth to fill in the answers to several questions about their tobacco use. In this survey c
    6·1 answer
  • A DNA strand has 30% guanine. How much adenine would there be in the same strand
    15·1 answer
  • in a strike-slip fault, the rocks on either side of the fault slip past each other sideways with little a. noise. b. shaking. c.
    9·2 answers
  • When cells come together they form........., which make up organs, which are
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!