1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna11 [10]
4 years ago
6

What are the 3 layers of the Sun from the inner layer to the outer layer?

Biology
2 answers:
Bogdan [553]4 years ago
8 0
The answer to ur question is C
tankabanditka [31]4 years ago
5 0
The answer is (C) Core, Radiative Zone and then the Convection Zone
You might be interested in
Need help please! ASAP
Musya8 [376]
Protista
Most protists are single- celled. The cells have a nucleus like plant and animal cells. Some of these organisms kind of act like plants and some of them kind of act like animals. Some of them are like both.
6 0
3 years ago
The father of a 2-year-old phones the emergency department on a sunday night and informs the nurse that his son put a bead in hi
DENIUS [597]
The answer is"you should bring your child to the emergency department tonight so the bead can be removed as soon as possible." I really hope this helps you.
4 0
3 years ago
In mice, agouti fur is a dominant trait resulting in individual hairs having a light band of pigment on an otherwise dark hair s
Vilka [71]

Answer:

The answer is given below

Explanation:

The 2 traits of the agouti fur mice are determined by non linked genes, which assort independently.

For this purpose we will use the multiplication rule to calculate the probability of agouti brown offspring  (A_ bb) from AaBb parents.

The probability of A_ offspring is 3/4 and the probability of offspring bb is 1/4.

The total probability will be 3/4 x 1/4 = 3/16.

5 0
4 years ago
When the stimulus intensity is increased what changes the number of synaptic vesicles released or the amount of neurotransmitter
DaniilM [7]
The number of synaptic vesicles are increased.
5 0
4 years ago
Amino acids are usually taken up into animal cells using a coupled transport system in the plasma membrane. Clearly stated in th
exis [7]

Answer:

It requires energy

Explanation:

In the coupled transport system, coupled carriers couple the inward transport of one solute across the membrane to the outward transport of other solutes across the membrane. The tight bonding that occurs between the transport of two solutes allows these carriers to utilize the energy stored in one solute, usually an ion, to facilitate transport of the other. With this way, the free energy released during the movement of an ion down an electrochemical gradient is utilized as the driving force to transport other solutes inwards, against their electrochemical gradient.

3 0
3 years ago
Other questions:
  • Earth is an open system with respect to
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • What would happen when an artificial K+ channel is inserted into an axon membrane at resting potential?Answer questions 1-4 by s
    14·1 answer
  • PLEASE HELP ME ANSWER THIS QUESTION....QUICKLY BFORE BUNNY EAT YO PIZZA .
    10·2 answers
  • For any activity such as running, jumping, or hunting, animals have to use energy obtained from food. What organelle similar fun
    12·1 answer
  • What levels of organization exist between organism and ecosystem
    9·1 answer
  • Which structure could a scientist look for in a plant that would identify it as a club moss rather than a liverwort?
    15·2 answers
  • Indoor air pollution has increased as improvements have been made in
    8·2 answers
  • Which best describes Earth’s crust?
    9·2 answers
  • Provide a specific example of different parts of the body (like organs, organ systems, or tissues) working together to accomplis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!