Hi

Biology

2 answers:

Pavel [41]3 years ago

6 0

Answer: C. using only unleaded gasoline.

Explanation:

The unleaded gasoline is devoid of lead, this prevents the engines of the vehicles from getting damaged. Also the leaded gasoline or lead containing fuel emits harmful gases to the atmosphere after combustion. These gases can cause harmful diseases in humans and animals. But unleaded gasoline does not emit such harmful gases to air. This will prevent the pollution of air. Also the water body will remain protected against the pollution as the harmful gases liberated from leaded gasoline may dissolve in water.

Jlenok [28]3 years ago

3 0

C is the proper answer. They have been reduced by using unleaded gasoline because lead can harm the air and water we breathe, so using less of it will help reduce the pollution being caused by it.

You might be interested in

If the amount of pollution is the same in the ocean where the fish are being caught, why

Ulleksa [173]

Answer:

Because they might be taking in a higher concentration of the toxin through food or their environment or others could just be older meaning theyve ingested more of the toxin overtime

Explanation:

8 0

3 years ago

what type of cell has a flagellum on its surface an animal cell, a viral cell, a plant cell, or a diseased cell

Elena-2011 [213]

An animal cell is your answer.

4 0

3 years ago

which process separates duplicated genetic material within the nucleus of a parent cell to create two daughter cells with identi

svlad2 [7]

Mitosis (mitotic cell division)

8 0

3 years ago

Read 2 more answers

5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.

dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'

8 0

3 years ago

Epimysium Select one: a. surrounds individual muscles. b. separates muscle fibers. c. connects muscles to bone. d. is a type of

sweet-ann [11.9K]

Answer:

a. surrounds individual muscles.

Explanation:

Individual muscle fibers have layers of connective tissue surrounding them. Epimysium, perimysium, and endomysium are the three layers of connective tissue that extend from the fascia and protect the muscle fibers. Epimysium is the outer most layer of connective tissue of individual muscle fiber. It encircles the entire muscle. Epimysium consists of dense irregular connective tissue. It serves to separate the muscle fibers from the other types of tissues present in the area to facilitate their independent movement.

6 0

3 years ago

Read 2 more answers