1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
5

Unwrapped food placed in a freezer experiences dehydra- tion, known as “freezer burn.” why?

Biology
1 answer:
sweet [91]3 years ago
6 0
Vapor pressure should be the answer
You might be interested in
Need help ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Still have more work to do please help!!!!!!!!
irinina [24]

Answer:

1. Hydraulic Dam

2. Small Shops

3. Town Hall

4. Special Carts

5. Postal Office

6. Steel Widget

7. Large Wooden Fence

8. Scrap Yard

9. Carpenter's Union

Explanation:

Hope this helps!

7 0
2 years ago
Read 2 more answers
While receiving a blood transfusion, the client suddenly shouts, "I feel like someone is lowering a heavy weight on my chest. I
xz_007 [3.2K]

Answer:

Stop the transfusion and administer normal saline.

Explanation:

The client is most likely experiencing Haemolytic Transfusion reaction. This reaction occurs when the receivers immune system destroys the red blood cells of the incoming blood. A common symptom is the feeling of impending doom.

The best line of action is to stop the transfusion immediately and administer normal saline.

4 0
2 years ago
You mix activated yeast with different carbohydrates and measure the CO2 production over a time span of 10 minutes for each type
LenaWriter [7]

Answer:

quantitative analysis

Explanation:

Qualitative analysis refers to quality whereas quatitative analysis refers to the amount or quantity. In this experiment, we see how much carbondioxide gas is produced after the use of different carbohydrates given to the yeast. In this experiment, we want to know the concentration of the product in the reaction not the quality so we can say that this experiment shows quantitative analysis as compared to qualitative analysis.

3 0
3 years ago
Between which two letters does mitosis occur
sdas [7]
One of them i think is biolorgy with 5th and 6th
6 0
3 years ago
How did sir francis believe the basic laws of science should be determined
REY [17]
<span>Sir Francis Bacon believe basic laws of science should be determined by using deductive reasoning based on empirical evidence. </span>
8 0
3 years ago
Other questions:
  • When a solution of cesium chloride (CsCl) is subjected to high-speed centrifugation, a stable density gradient is formed. Mesels
    11·1 answer
  • What is the final electron acceptor in the light reactions?
    7·1 answer
  • What are ways lipids are useful to living organisms
    8·1 answer
  • What is the difference between climate and weather? If you’re not sure, take a guess.
    8·1 answer
  • 1. PCR is the abbreviation for _______________.
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • During DNA replication, the DNA molecule combines into two strands. Please select the best answer from the choices provided
    5·1 answer
  • Why are diseases transmitted by vectors harder to control than othwrs
    6·1 answer
  • PLEASE HELP THIS IS SO IMPORTANT UGH ITS 25 points
    12·2 answers
  • the study of how psychological, neural, and endocrine processes combine to affect our immune system and health is called
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!