1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
9

explain how complete dominance, co dominance, incomplete dominance, and sex linked traits are inherited and expressed differentl

y
Biology
1 answer:
dlinn [17]3 years ago
5 0
<span> COMPLETE DOMINANCE:
</span>
<span>Mendel concluded that some alleles are dominant and others are recessive. When one dominant allele is present, it's enough to make the recessive allele unexpressed (this is what happens in heterozygous individuals). In other words, it 'hides' or masks the recessive allele.

CO-DOMINANCE:

-a condition in which both alleles are dominant.
</span>
There are alleles that have the capacity of dominating at the same time, and when an organism is heterozygotic, both alleles are expressed.
For example, a white chicken(WW) crossed with a black chicken (BB):  100% of the offspring being WB. With this genotype, they have black feathers and white feathers.
It's not a blend of colors, but a case where both are expressing.

INCOMPLETE DOMINANCE:
-a condition with none of the alleles is dominant or recessive, so the traits blend in the phenotype.

Some alleles are not completely dominant, and when that's the case the phenotype of a heterozygous organism will be a mix between the phenotypes of its homozygous parents.

For example:
plant 1: RR -red
plant 2: rr- white

By crossing this plants we will obtain 100%  of the offspring with a color mix: pink.(genotype: Rr)
Red and white are not completely dominating so it results in a blend of colors.

SEX LINKED TRAITS

Sex chromosomes contain genes that determine the sex of a person. Two X chromosomes result in a female and one X plus a Y result in a male.

In those chromosomes, there are genes specific for each gender, and in those chromosomes, there are genes that code for certain traits- the sex-linked traits.
These traits will be inherited according to the sex chromosomes they receive from their parents.









You might be interested in
Methane is an example of a molecule whose Adams are held together by which of the following
irakobra [83]

It’s a covalent bond.

3 0
4 years ago
A scientist is studying the respiration reactions carried out by a certain bacterium. Which of these would indicate that the res
natita [175]
A and B are the exact same option.

The answer is that the production of ethanol indicates anaerobic respiration.
7 0
3 years ago
Read 2 more answers
A rise in the partial pressure of carbon dioxide will cause a __________ in ph and a __________ in blood bicarbonate levels.
ahrayia [7]

fall & rise.. The initial compensating response to an acute respiratory alkalosis is a modest decline in ECF bicarbonate concentration as the result of cellular buffering. Subsequent renal responses result in decreased ECF bicarbonate concentration through reduced renal bicarbonate reabsorption.

8 0
4 years ago
Maintaining the integrity of the stock reagents is a constant concern in the lab environment. Read the situations and decide if
Anarel [89]

Answer:

Question is incomplete i have added full question at the end of this answer because im not able to add it in ask for detail section.

Answer:

1. Contaminate (Because NaOH is a base while H2SO4 is an acid. If student mix both this will result in chemical reaction.)

2. Contaminate (Because returning regents  are used already id used regents put back in the bottle it will contaminate the fresh reagents.)

3. Contaminate (Using same spatula without sanitation results in mixing of one reagent into other regents which results in failure of experiments.)

4. Does Not Contaminate (It does not have any effect on the reagent because solid reagents are weighted that can be cleaned off when poured into reaction flask.)

5. Does Not Contaminate (Because washing flask after each experiment will wash off the left reagents present in flask.)

6. Contaminate (This will result in contamination because potassium iodide (KI) solution will be mixed with waste)

FULL QUESTION

Maintaining the integrity of the stock reagents is a constant concern in the lab environment. Read the following situations and decide if each represents a valid contamination concern.

1. A student uses a pipet designated for the NaOH solution to pipet the H2SO4 solution.

2. Several students have left-over reagents after the completion of an experiment and decide to return the excess reagents to their original containers.

3. Only one spatula is available to measure out several different white powders.

4.Rather than wasting multiple weigh boats, a student decides to wash and dry a single weigh boat in-between uses.

5. A group of students must use the same 500 mL volumetric flask to make solutions. Between each use they wash and dry the flask.

6. At the end of the day, the waste bottle is so full that a student decides to dump his waste into an almost empty bottle of stock KI solution.

3 0
4 years ago
Active transport requires energy from the cell. A True <br>B False​
Vladimir [108]

Answer:

A TRUE

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Ocean water has a salinity of approximately 35,000 parts per million or 3.5%. What are the solute and solvent in ocean water? A.
    5·2 answers
  • Which of the following is the best demonstration of the fundamental attribution error?
    8·2 answers
  • What is a homogeneous, generally clear jelly-like material that fills cells.
    13·1 answer
  • The codes for making proteins are carried from the nucleus to the ribosomes in the cytoplasm by _____________. a. RNA b. mRNA c.
    8·2 answers
  • Please help!!! Owls and hawks both eat rodents. They are also found in the same habitats. Since no two populations can occupy ex
    10·1 answer
  • Which of the following is NOT a type of volcano?
    9·2 answers
  • What to do to reduce weight and become thin in 1 month
    15·2 answers
  • What was the total maginification (25 points)
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Muscles are named according to their:____________.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!