1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
4 years ago
13

Imagine a pool ball that bounces off of a bumper and

Biology
1 answer:
Naddik [55]4 years ago
4 0

Answer:

The kinetic energy is transferred from the ball to the bumper. The bumper gives the same energy back and the ball eventually stops due to friction of the ground.

Explanation:

Hope this helps y'all <3

You might be interested in
In fermentation, which step of cellular respiration is being accomplished?
Annette [7]
The process that occurs in a cell when there is not enough oxygen is called fermentation. Fermentation occurs through the process of Anaerobic Respiration, where instead of using oxygen, organic and inorganic molecules are used as final electron acceptors. The by-product of this process is usually alcohol, ethanol, or acetic acids.
<span>
Fermentation is commonly used in lactic acid (in muscles) and alcohol (beers, whiskey) fermentation where the by-product is ethanol. Yeasts are a common organism that uses this process, where it convert sugars into alcohols or acetic acids.</span>
7 0
3 years ago
How does a population reach carrying capacity?Give examples.
Mashcka [7]

Answer: By either emigration or natural increase.

Explanation: Natural increase is where in a population, the birth rate, or number of live births per year, is greater than the death rate, or deaths per year. Emigration is when individuals leave their region to move to another, often due to economic or political reasons. Eventually, a population will reach its carrying capacity, where the land the population occupies is only just able to support the population. Once the carrying capacity is breached, the population will start to collapse.

4 0
3 years ago
Which vitamin is required for synthesizing heme, a portion of hemoglobin found in blood?
Arlecino [84]
Vitamin B6 (pyridoxine)
6 0
3 years ago
How many years would it take the Atlantic Ocean to grow 500 centimeters
sladkih [1.3K]
I think 167 because it takes 1 year for it to grow 3 cm so 500/3 is 167
4 0
3 years ago
Read 2 more answers
What is an organism made up of many cells called
Setler [38]
The correct answer in multicellular
5 0
3 years ago
Read 2 more answers
Other questions:
  • Why do constellations in the night sky change seasonally? A. Earth rotates around its axis. B. Earth revolves around the sun. C.
    13·1 answer
  • Which of these is a physical property?
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why can an exogenous protein, protein that is added by experimentalists that has the same amino acid sequence as endogenous prot
    12·1 answer
  • Practice the above directional terms by describing the following relationships: The trachea (windpipe) is ___________ to the eso
    7·1 answer
  • 1. Which of the following best explains how
    8·1 answer
  • It is possible to determine a person’s exact date of birth from their bones.
    11·1 answer
  • How do geologist look at a mountain and determine its approximate age based on physical features?
    14·1 answer
  • Explain what is probably going wrong in the following scenario.
    15·1 answer
  • Please help Think about the effect that NASA technologies have on your everyday life. What’s your opinion of the reciprocal rela
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!