1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
netineya [11]
3 years ago
9

Which term refers to the condition that exists when no net change in

Biology
1 answer:
lidiya [134]3 years ago
4 0

Answer:

B. equilibrium

Explanation:

Equilibrium is a term that refers to the condition that exists when no change in concentration results from diffusion.

At equilibrium state, the system is at rest or in motion.

  • The rate of forward processes is equal to the rate of the backward process.

Concentration is the amount of solute found in a solution.

Osmosis is the movement of solvent through a semi-permeable membrane.

Randomness is the degree of disorderliness of a system.

You might be interested in
Summarize the facts about Huntington's disease by completing the concept map below.​
hram777 [196]

Answer:

There is no effective cure.

the disease is caused by a single defective gene on chromosome 4.

the disease causes a breakdown of nerve cells in the brain.

as early as age 2 or as late as 80. but usually 30 and 50.

molecular analysis, i don't know the last words sorry

3 0
3 years ago
Imagine there was no tilt to the earths axis and earths orbit was circular
Shkiper50 [21]

Answer:

If the Earth was not tilted on its axis, there would be no seasons. And humanity would suffer.

Explanation:

When a Mars-size object collided with Earth 4.5 billion years ago, it knocked off a chunk that would become the moon. It also tilted Earth sideways a bit, so that our planet now orbits the sun on a slant.

Hope this helps!

Brain-List?

7 0
3 years ago
Which of these is one of the nitrogenous bases in DNA?
Ne4ueva [31]
D is the answer to the problem





8 0
3 years ago
Read 2 more answers
The passing of electrons along a series of molecules, releasing energy bit- by-bit as they go, is called the 1. Calvin Cycle 2.
Nuetrik [128]

Answer:

Cycle 3: The electric transport chain!

8 0
3 years ago
Which term best describes a system in an animal‘s body
allsm [11]

Answer:

what terms are there can you let me know?

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • A chemical with _____ (low or high) persistence tends to break down quickly in the presence of sunlight.
    14·1 answer
  • A person working in your lab creates a synthetic semi-fluid like substance embedded with proteins that transport nutrients and i
    5·1 answer
  • All living things need food and a place to live. Which below is also something all living things need to live? A. a family B. wa
    12·2 answers
  • While assembling a skeleton of a new species, a scientist points to one of the bones and observes that it looks like the most li
    14·1 answer
  • Explain the instinctive behaviors that pelican do to get the food they need to survive
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Why does the land around a once active coal mine remain barren?
    11·1 answer
  • How is the skeleton o<br><br>f a birds different from a dog<br>​
    10·2 answers
  • Methods of excreation in plants?
    13·1 answer
  • 61. If tyrosine and isoleucine undergo condensation, the new bond that is formed is between the:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!