1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
3 years ago
12

Rules for naming plants and animals are found in _____ .

Biology
2 answers:
-BARSIC- [3]3 years ago
6 0

Answer: Option C.

Explanation:

The International Code of Nomenclature is the rule that is accepted internationally for naming new plants and animals.

For naming animals the rule is named as International Code of Zoological Nomenclature (ICZN) and for naming plants, algae and fungi the rule is named as the International Code of Nomenclature (ICN).

The basic rule for International Code of Nomenclature involves that, the first part of the name helps in identifying genus to which the species belongs  which is the generic name and the second part which is the specific name helps in identifying the species in the genus.

for example animal nomenclature - Homo sapiens (Human) and plant nomenclature - Pisum sativum (Pea).

Hence, the correct option is C.

polet [3.4K]3 years ago
4 0
Rules for naming plants and animals are found in the International Code of Nomenclature. 

Answer: C) or the third option.
You might be interested in
Very large premolar and molar teeth, a sagittal crest, heavy mandibles, and wide zygomatic arches are found in modern gorillas,
Dovator [93]

Answer:

The correct answer will be option- Australopithecus.

Explanation:

<em>Australopithecus</em> is an extinct genus of a large group of animals called primates. This genus is closely related to humans which may or may not be ancestors of <em>Homo sapiens</em>.

Australopithecus exhibits traits of both ape and human-like which is distinguished by the small size of the brain, smaller canine teeth but large molar and premolar teeth, broad dish-shaped face, sagittal crest, large molar teeth, flared zygomatic arches and sloping forehead.

Thus, option- Australopithecus is the correct answer.

5 0
3 years ago
If a person with O blood type produces offspring with a person with B blood type, then what percentage of their offspring will b
levacccp [35]
Maybe its 50 percent
6 0
3 years ago
A primary healthcare provider prescribes a urinalysis for a client with an indwelling catheter. to ensure that an appropriate sp
Leokris [45]
The nurse should obtain the specimen from the catheter.

One of the tests from urinalysis that frequently got contaminated is about infection. The area near the orificium of uretra is near the skin, so there will be microbes around it that can contaminate the sample. The contaminated sample will give a false positive and the result will show the urine are infected.
Taking the specimen from catheter will prevent that contamination, thus giving a better sample.
4 0
3 years ago
Read 2 more answers
Identify the missing numbers 5.6 × 1012 / 3.5 × 109 = A × 10B A= B=
AnnyKZ [126]

Answer:

A= 1.6

B= 3

Explanation:

8 0
3 years ago
Read 2 more answers
When cells were first taken from henrietta lacks, she was _____. mastering biology?
Bond [772]
The correct answer is that "she was suffering from cervical cancer".

Henrietta Lacks was known to be <span>an African-American </span>female<span> whose </span>cancer<span> cells are the </span>source<span> of the HeLa </span>cellular<span> line, </span>the primary<span> immortalized </span>cellular<span> line and </span>one of the most important cellular lines<span> in </span>scientific studies<span>. An immortalized </span>cell<span> line will reproduce indefinitely </span>beneath particular conditions<span>, and the HeLa </span>cell<span> line </span>continues to be<span> a </span>source<span> of </span>helpful clinical records<span> to the </span><span>contemporary</span>
6 0
3 years ago
Other questions:
  • Which of the following best explains how a scanning electron microscope is used to produce an image of a specimen? An electron b
    13·2 answers
  • Which of the following helps plant cells remain rigid? A. cell membrane B. nucleolus C. capsule D. central vacuole
    10·1 answer
  • Directional selection only occurs in response to naturally occurring events.
    5·1 answer
  • Biotic potential and _____ determine_____.
    15·1 answer
  • #31-35 please, I'm so confused :(
    15·1 answer
  • What is the origin of the Slate breed?<br>O<br>United States<br>O Mexico<br>O Asia<br>O Germany​
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the diameter of one algal cell
    13·1 answer
  • An athlete would like to supplement his diet with the highest concentrate whey protein. What form of whey protein is recommended
    11·1 answer
  • Tesla is the unit for ___. <br> A. Luminous intensity <br> B. Magnetism <br> C. Length<br> D. Heat
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!