1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
3 years ago
7

What is transpiration

Biology
2 answers:
oksano4ka [1.4K]3 years ago
8 0
It is a stage in the water cycle where it takes water off of plants and grass/dew ext. Hope this helps! ;D
gtnhenbr [62]3 years ago
7 0
Transpiration the water movement through a plant and its evaporation.  
You might be interested in
What is taxis? Can you provide an example
ziro4ka [17]

Explanation:

a type of vehicle for hire with a driver

6 0
2 years ago
Question 9 (1 point)
Dimas [21]

Answer:

True

Explanation:

It is true as in Mendel's law of inheritance

7 0
3 years ago
Read 2 more answers
___________________, produced by stem cells found in bone marrow , manufacture antibodies used to counter the effects of antigen
lesya [120]

Answer:

B cells develop into plasma cells that make antibodies to fight infection.

7 0
3 years ago
Read 2 more answers
What is the serosa?
FinnZ [79.3K]
The correct option is A.
The serosa refers to the outermost layer of loose connective tissues which is often covered by mucus and which contains blood vessels. In the gastrol intestinal tract, the serosa refers to the outermost layer of the wall of the GI tract. One major function of serosa is to reduce friction from muscle movement. 
3 0
3 years ago
What is the process by which a cell duplicates its chromosomes and splits into two cells?
Lesechka [4]
Cell division. The whole process involves 3 main stages namely interphase, mitosis and cytokinesis.It would, however be wrong to say that its mitosis only because mitosis does not involve the duplication of chromosomes. Duplication of chromosomes occur during the interphase while the splitting of cells occur during Telophase of mitosis and Cytokinesis. Therefore, answer to this has to be generalised to be just cell division.
8 0
3 years ago
Other questions:
  • Emdr is most similar to a technique known as
    8·1 answer
  • Importance of nutrient cycles
    7·1 answer
  • Carbon has an atomic mass of 12 and an atomic number of 6, so the number of neutrons must be ____
    14·1 answer
  • How many homologous chromosome alignments are possible for independent assortment during meiosis?
    7·2 answers
  • Parents can pass on chromosomes to their children that are different than their own when the new gene combinations are created b
    6·2 answers
  • Which of the following statements is correct about bound ribosomes?
    8·1 answer
  • Han’s younger sister is riding her tricycle in a straight line. Her speed is 2.5 m/s. After 5 seconds, she comes to a stop. What
    8·1 answer
  • Please someone help! science question i willl give brainlest plesee don’t ignore <br> THANK YOU
    6·1 answer
  • _____ has recommended ethics regulations to accompany the new genome advances.
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!