1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
3 years ago
12

What is evidence that each color of visible light has a wave of a specific wavelength. pls help me :)

Biology
1 answer:
aliina [53]3 years ago
8 0

Answer:

Dispersion of white light by a prism

Explanation:

When white light is passed through a prism, the white light separates into its component wavelengths which are:

Red

Orange

Yellow

Green

Blue

Indigo

Violet

Together, all of these wavelengths constitute the spectrum of white light.

Hence, the dispersion of white light shows that each color of visible light has a specific wavelength.

You might be interested in
Describe the process of vaccination.
denis-greek [22]

Answer:

Vaccination involves showing the immune system something which looks very similar to a particular virus or bacteria, which helps the immune system be stronger when it is fighting against the real infection.

Explanation: "it is what it is".

5 0
3 years ago
Aspectos de la célula que estudia la : citologia , bioquímica y la genética
Brilliant_brown [7]

Answer:

I don't know what this says!

Explanation:

6 0
3 years ago
Helphelp help gell help helpp
dimulka [17.4K]
I think bread; i’m 90% sure
5 0
3 years ago
A man with normal vision marries a color-blind woman. Red-green color blindness is an X- linked recessive disorder. They have a
jeyben [28]

Answer: The probability is 100%.

Explanation: The chromosome X is related to gender. A man carries two different chromosomes (XY) and a woman carries two similar chromosomes (XX). The offspring of a couple will inherited:

  • If it is a boy, he inherites the chromosome Y from his father and X from his mother;
  • If it a girl, she inherites X from her father and X from her mother;

In the question, the woman is color-blind, which means she carries the recessive alleles: X^{d}X^{d}

The man, on the other hand, is normal, so his X-linked genotype will be: X^{D}Y.

Now, since they have a daughter, she inherited her double X from each of her parents, which means she inherited one X^{d} from her mother and one X^{D} from her father.

So, the daughter's genotype can only be heterozygotic  X^{D}X^{d} in other words, the probability is 100%.

5 0
3 years ago
In an experiment, shara feeds her rat different brands of rat food (brands x, y, and z) each for 2 weeks and weighs the rat over
Advocard [28]

The variables are defined as the factors in an experiment, which are liable to change. The variable can be dependent or independent. The Independent variable is a variable, which is unaffected by the changes in the other variables.

In this case, the brand of the food Shara feeds to the rats is independent factor, but it is changes in the system, so, it is an independent variable.

The effect on the weight of the rat is dependent on the brand of food they are consuming. So, the weight of rats is dependent variable.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why do scientists typically include as large a sample size as possible in their experiments?
    5·1 answer
  • In what types of habitats do mammals live?
    6·2 answers
  • What's the answer to number 17 and 18?
    11·1 answer
  • The most common form of producers found on earth are
    14·1 answer
  • How does the pharmacy computer system sequence multiple plans for one patient?
    12·2 answers
  • What would be the flow of the water and salt in or out of the plant cells?
    7·1 answer
  • Which of the following can occur at breaks in the earth's crust?
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The purpose of the phospholipid bilayer.
    15·1 answer
  • Which solution is most acidic?<br> A.pH=3<br> B.pH=7<br> C.pH=10<br> D.pH=14
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!