1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
2 years ago
8

What is an origins that reproduces among themselves?

Biology
1 answer:
QveST [7]2 years ago
8 0
My Answer: RNA molecules

Why?: " <span>Catalysts with this special self-promoting property can use raw materials to reproduce themselves and thereby divert these same materials from the production of other substances."

Hope I helped! :D</span>
You might be interested in
A client with type 1 diabetes presents to the diabetes educator and asks about a change in insulin. The client's occupation requ
Anton [14]

Answer:

<h2>Insulin glargine</h2>

Explanation:

In case of type 1 diabetes, the body does not produce sufficient insulin or produce no insulin. The body breaks down the carbohydrates into blood sugar that it uses for energy,  and insulin is a hormone that removes glucose from the bloodstream into the cells of the body.  

Insulin glargine is a long-acting insulin that  works approximately for 24 hours.

Insulin glargine is used to blood sugar control with diabetes patients.

8 0
3 years ago
Need help with this one
rusak2 [61]

Answer:

i think its a but i am not absoulty sure

Explanation:

7 0
3 years ago
Read 2 more answers
E lements are _____.
Step2247 [10]

Answer:

A chemical element is a type of atom with the same number of protons in their <u>atomic</u> nuclei.

Explanation:

For an example, the atomic number of Chlorine is 17, and there is 17 protons in Chlorine.

If you have any questions feel free to ask in the comments.

4 0
2 years ago
Read 2 more answers
Please help me please
Bess [88]
Answer c
Because the lowest one is at the bottom near 5 and the top one is on 25m and for it to be at 11m will be the wrong answer.
4 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • amie is performing an experiment that involves chemicals, test tubes, and burners as part of her biotechnology workshop. Which o
    11·1 answer
  • The main difference between a taproot system and a fibrous root system
    9·1 answer
  • The species that are most vulnerable to extinction are those, which are
    10·1 answer
  • A cell will proceed to ________ only if the dna is undamaged and dna replication has occurred correctly.
    5·1 answer
  • How have the governments of the Romans and Greeks influenced our modern Western governments?
    8·1 answer
  • The thin layer of white blood cells and platelets found above the packed red cells in centrifuged blood is called the ______
    6·1 answer
  • _____ controls geotropism and phototropism. Auxin, Gibberellin, Cytokinin or Abscisic acid (ABA)?
    14·2 answers
  • The best treatment for a blister is to pop it, remove the skin covering the blister, and cover it with a bandage.
    5·1 answer
  • Assuming that all of these cells came from the same person, which of the following is true? A. Each cell contains the same DNA,
    9·1 answer
  • How many weeds are on the noxious weed list?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!