1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gemiola [76]
3 years ago
8

Select all that apply. Which statements apply to "food"?

Biology
1 answer:
Flura [38]3 years ago
8 0
Where is the statements
You might be interested in
What Gives Directionality To Carbohydrates?
uranmaximum [27]
The directionality to the carbohydrates is given by the isomerization of the carbohydrate molecules. Hence the plane polarised light decides the configuration of the carbohydrates such as dexter rotatory or levo rotatory. The anti-syn configuration is also responsible for the directionality of the carbohydrates.
8 0
3 years ago
Use the drop-down menus to complete each sentence.
kupik [55]

Answer:

the first one is preditation, the other one is competition, the last one is cooperation. :)

Explanation:

6 0
3 years ago
Read 2 more answers
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Study the cladogram. Which two organisms have dry skin? gorilla and shark shark and lizard lizard and tiger tiger and lamprey.
Rasek [7]

Answer:

It's C.

Explanation:

I chose B but I got it wrong. Since lizards obviously have dry skin, the other option with lizards is C. And you can also see in the cladogram that above "dry skin" is lizards and tigers.

So it's C.

6 0
2 years ago
Which is a result of chemical weathering?
monitta
The erosion or disintegration of rocks, building materials, etc., caused by chemical reactions (chiefly with water and substances dissolved in it) rather than by mechanical processes
3 0
3 years ago
Other questions:
  • In 1900, there were approximately 1.75 billion humans on earth; in 1950, there were approximately 2.3 billion; in the year 2025,
    13·1 answer
  • People who farm near the Sahara desert will benefit from GMOs because the GMO crops __________.
    9·2 answers
  • Oxytocin, which is synthesized in the hypothalamus, is secreted into the circulatory system of the body via the:
    14·1 answer
  • I need help > < i think the answer is C
    10·1 answer
  • The earth's continents move at certain times of the year due to the motions of the tectonic plates. True or false
    14·2 answers
  • What is an Otorhinolaryngologist
    14·1 answer
  • A woman with normal blood clotting ability whose father was a hemophiliac and whose mother was normal with no family history of
    12·1 answer
  • Which plant cell structure provides support for the cell
    8·2 answers
  • A farmer wants to grow spinach as quickly and cheaply as possible in winter. At what temperature should he keep his
    8·1 answer
  • . Professor Dr. Uppal Pal studied the Borrelia burgdorferi bacterium at the University of Maryland. Dr. Pal found that Lyme dise
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!