1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
15

Bleaching is caused by the addition of bleach containing fertilizers that enter marine systems through runoff. True False

Biology
1 answer:
julsineya [31]3 years ago
6 0

Answer:

False

Explanation:

You might be interested in
Study the image of moss and identify the label that describes rhizoids.
a_sh-v [17]

The answer is; C

Rhizoids are analogous to roots in vascular plants. They anchor the gametophyte of the moss into the substrate. The rhizoid is also significant in absorbing nutrient from the substrate just like roots. While roots of vascular plants are multicellular, rhizoids may be unicellular or multicellular. Unlike in roots where water is absorbed and passes through the roots up the plant, in rhizoids, water is carried by capillary action in between the rhizoid threads.


7 0
3 years ago
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
What is 18,000 expressed in scientific notation? 1.8 × 10–4 1.8 × 104 1.8 × 10–5 1.8 × 105
Arturiano [62]

10 raise to 4 multiple by 1.8 is the answer

8 0
3 years ago
Read 2 more answers
Why was miasma theory replaced?
vredina [299]

Answer:

Miasma theory was replaced because John Snow collected data that showed that germs cause disease.

Explanation:

The theory of miasma was proposed in the past when some scientists —like doctors Thomas Sydenham and Giovanni Maria Lancisi— thought that disease was the product of emanations originated by the decomposition of organic matter. This theory was based on the fact that diseases predominated in places with poor hygienic conditions.

John Snow, an english physician, was one of the main contributors to the <u>microbial theory of disease</u>. In 1854, while a cholera epidemic was occurring, he collected data and organized it statistically and then concluded that the disease was caused by germs present in drinking water. This <u>data was contrary to the miasma theory, which would eventually be displaced by the microbial theory of the disease</u>.

5 0
3 years ago
Which describes a likely advantage of the roots that gymnosperms have? They are shallow, preventing the plants from growing too
vfiekz [6]

The roots of eh gymnosperms are long and deep, with the advantage to gather deep water. Thus, option D is correct.

Roots are the important network of tissues that gathers the water and essential nutrients from the soil and allow growth.

<h3>What type of roots are in Gymnosperms?</h3>

The gymnosperms are advanced plants with bare seeds. The roots system in the gymnosperms is the taproot system.

The root system in the gymnosperm is the long deep roots that are immersed deep inside the soil.

Thus, the advantage of roots to gymnosperms arises from the deep root for gathering water below the surface. Thus, option D is correct.

Learn more about gymnosperms, here:

brainly.com/question/4526473

6 0
2 years ago
Read 2 more answers
Other questions:
  • Biology lesson 1.05 how do i do the chart flvs
    9·1 answer
  • Starch is a monosaccharide true/false
    6·1 answer
  • What is the best definition of a eukaryotic cell?
    5·2 answers
  • What are 4 things organisms need to survive
    10·2 answers
  • Relatively little is known about many obligate anaerobes. Why might this be so? A. The obligate aerobes are far more numerous, a
    5·1 answer
  • Which one of the following statements about Darwin and Wallace is TRUE?
    12·1 answer
  • Without the presence of sea otters, sea urchins would otherwise overgraze kelp beds, dramatically changing the marine community
    12·2 answers
  • An 8-kilogram bowling ball is rolling in a straight line toward you. If its momentum is 16 kg·m/sec, how fast is it traveling?
    15·1 answer
  • What is the primary role of nitrogen fixing bacteria in the Nitrogen Cycle?
    7·1 answer
  • Help whats the answer this is for science
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!