Answer:
Amoeba is a unicellular organism
All cells are similar in composition and metabolic activities
Answer:
Ratio = 
Explanation:
Side of a cube, a = 20 µm
The surface area of a cube, A = 6a² (a is side of the cube)
The volume of a cube, V = a³
The ratio of the surface to volume ratio of the cell will be given by :
So, the ratio of the surface to volume ratio of the cell .
Based on the description above, the phenomenon that is being described is called SYNERGISM. Synergism occurs in this when both GH and Testosterone are being used and created a rather better outcome that it is given separately. The combined effect gave a better result.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
