1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
4 years ago
12

How do we know the frequency of a wave when we can't see it?

Biology
1 answer:
Anastaziya [24]4 years ago
6 0
You find the frequency of a wave by V/WL.
You might be interested in
Which of the following is an example of an emphasis on production quality?
ivanzaharov [21]

Answer:

Emphasis is on pollution cleanup.

Explanation:

got it right on odyssey ware

5 0
3 years ago
Where would you expect to find water stored as a gas
Alenkasestr [34]

In the atmosphere.

Hope this helped!


-Payshence

5 0
3 years ago
Read 2 more answers
The type of muscle shown here is found only in the heart. it is
murzikaleks [220]
Cardiac Muscle, reason its called Cardiac attack when you have that sort of " Heart Attack "
6 0
4 years ago
Read 2 more answers
Plants that produce seeds within a cone are called _____.
Sedbober [7]

Answer:

Gymnosperm

Explanation:

8 0
4 years ago
Fred is studying his notes from anatomy class. One list in his notes describes features of a CNS structure.
natta225 [31]

ans is D. Most items are features in the spinal cord, but the hippocampus is in the brain.

6 0
4 years ago
Read 2 more answers
Other questions:
  • During the process of meiosis, chromosomes replicate
    9·1 answer
  • The cellular component responsible for transmission of traits and control of cell function was long assumed to be proteins. Disc
    7·1 answer
  • A galvanometer is a device that measures small currents.<br> a. True<br> b. False
    13·2 answers
  • Do eukaryotic cells replicate their DNA in the cytoplasm and nuclus?
    13·1 answer
  • The neurobiological approach explains human behavior by focusing on I. brain structures. II. cultural influences. III. neurotran
    11·1 answer
  • Anyone know this?????
    9·1 answer
  • Total Pieces of Food Eaten 57 153 90 Food Percentage* 19 % 51 % 3 % Simulated Number of Birds in Flock for 2nd Generation**
    12·1 answer
  • Which of the following statements about active transport is true?
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • List and describe three of the five characteristics of life. * help pls i give 50 points
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!