1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lapatulllka [165]
3 years ago
14

Which best describes the scientists who contributed to our current body of

Biology
2 answers:
Vitek1552 [10]3 years ago
7 0
The answer of people of all races
olya-2409 [2.1K]3 years ago
6 0

Answer:B

Explanation:

You might be interested in
What is the smallest structural and functional unit of living organisms
steposvetlana [31]

Answer:

Cell is the smallest and function unit of living organism.

Explanation:

It is the basic unit of life.

4 0
4 years ago
Read 2 more answers
So-called "dark matter" cannot be directly observed because
Inga [223]

Answer:

B. it gives off no radiation

Explanation:

Dark matter is so named because it neither absorbs nor emits light and therefore cannot be directly observed.

5 0
3 years ago
Read 2 more answers
The cell cycle is a spontaneous occurrence where the cell shrinks to less than half its size
otez555 [7]
Your answer is False

Hope this helped!!!
3 0
3 years ago
Read 2 more answers
Besides race, what other things explain why some people might be more susceptible than others to disease? think about the girl i
madam [21]
The sickness can originate from her predecessors, it's as of now in her qualities. Expires don't have anything to do with races. 
Race and wellbeing allude to the connection between singular wellbeing and one's race and ethnicity. Contrasts in wellbeing status, wellbeing results, future, and numerous different markers of wellbeing in various racial and ethnic gatherings is all around recorded, alluded to as wellbeing abberations. The race is an intricate idea, and the two noteworthy contending speculations of race utilize organic definitions and social development to characterize the racial distinction.
6 0
4 years ago
A person who has a distorted view of their body and who weighs less than 85% of normal is said to have
katen-ka-za [31]
That sounds like the disorder anorexia.
5 0
3 years ago
Other questions:
  • The questions of how chemicals flow and energy cycles between organisms and their surroundings are addressed in the study of whi
    9·1 answer
  • An atom consists of three types of particles: proton. Electron, and neutron. Each atom of an element has the same number of whic
    9·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Metabolic control analysis ____.
    13·1 answer
  • Which of the following is not true about arid deserts
    13·2 answers
  • Wind Circulation or ___ cells, are driven by differences in temperature
    6·1 answer
  • In order to get a single solution to a linear system having two variables
    7·1 answer
  • A student observes a liquid substance in water which beads up on the surface of water and does not dissolve. This substance must
    6·1 answer
  • TRUE or FALSE
    13·1 answer
  • Why can't land animals evolve a better eye
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!