1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
8

Where do baymouth bars form across bays? A. where there is no longshore current nearby B. where strong currents move in and out

daily C. where sea stacks stand on both sides of the entrance D. where currents are weak
Biology
2 answers:
algol133 years ago
8 0
Baymouth bars form across bays : D. Where the currents are weak
The sediments will be carried out/disrupted when the currents are strong. When the currents are weak, the sediment will finally able to be deposited 

hope this helps
snow_lady [41]3 years ago
7 0
ANSWER
D. where currents are weakened
derp derp derp derp derp derp
You might be interested in
What temperature must milk reach to be pasteurized?
sleet_krkn [62]

Answer:

145 F

Explanation:

Pasteurization of milk widely practiced in several countries, notably the United States, requires temperatures of about 63 C  145 F maintained for 30 minutes or, alternatively, heating to a higher temperature, 72 C (162  F), and holding for 15 seconds and yet higher temperatures for shorter periods of time :D

8 0
3 years ago
Read 2 more answers
What do living things use to carry out life functions
Rom4ik [11]

Answer:

Food=Energy

Explanation:

All of these life forms carry out life processes such as growth, metabolism, and reproduction.

7 0
4 years ago
How can you lift an elephant with one hand? <br> If you can answer this you can be the brainliest!
Nina [5.8K]

Answer:

By letting the elephant lift you hand?!!

Explanation:

I have no idea

BUT......

Please mark BRAINLIEST!!!!

3 0
4 years ago
Read 2 more answers
Which is true of prokaryotic and eukaryotic cells?
pentagon [3]

Answer:

Prokaryotic cells are larger than eukaryotic cells. Eukaryotic cells do not have nuclei, and prokaryotic cells do have nuclei. Prokaryotic cells lack membrane-bound organelles, and eukaryotic cells contain membrane-bound organelles.

6 0
4 years ago
Name the pituitary hormones that have other endocrine glands as their target organs (include the hormone's abbreviation). Additi
Step2247 [10]
Here you go i hope this helps

8 0
3 years ago
Other questions:
  • Can you get heart problems from eating too much reddit
    13·1 answer
  • Write any two uses of pseudopodia in amoeba​
    5·1 answer
  • It is thought that two prokaryotes combined to form a(n) _______. A. amoeba B. eukaryote C. protozoan D. pseudopod
    11·1 answer
  • What represents Earth’s “modern commons”? *
    13·2 answers
  • 30,000,000 white-tailed deer in the United States, which covers 3,536,000 square miles. What is the population density, rounded
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Labeled parts of a DNA molecule
    10·2 answers
  • What are common names for diagerge syndrome
    5·1 answer
  • She enjoys studying fossils. She learned how fossils called index fossils are found in the rock layers. The index fossils help s
    13·1 answer
  • An organism to obtain its nutrients is called a ____
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!