1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
3 years ago
12

Sand that extends from a coast into open water is called a barrier spit. a. True b. False

Biology
1 answer:
AysviL [449]3 years ago
6 0
<span>It is True - Sand that extends from a coast into open water is called a barrier spit.

Barrier spits are formed when there is a deposit on the shoreline due to the lateral movement of water.

The waves are known to hit the shoreline at a particular angle which cause the lateral movement of water accompanied with the sedimentation along the coastline in the direction of the wave motion.</span>
You might be interested in
Which part of bone marrow is
Thepotemich [5.8K]

Answer: the answer is B

Explanation: Yellow bone marrow is involved in the storage of fats. The fats in yellow bone marrow are stored in cells called adipocytes.

3 0
2 years ago
Please it's my last question
Aloiza [94]

Answer: true i think

brainliest???

Explanation:

5 0
3 years ago
Read 2 more answers
what is the mutation caused by the addition of a nucleotide to an already existing gene sequence called
Harlamova29_29 [7]
The mutation<span> caused by the addition of a nucleotide to an already existing gene sequence is duplication.</span>
7 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Which type of sickle sell is anemia
Sidana [21]

Hemoglobin SS and sickle beta zero thalassemia are the most severe forms of sickle-cell disease and are sometimes referred to as sickle cell anemia. Hemoglobin SC disease is considered moderate and in general, sickle beta plus thalassemia is the mildest form of sickle-cell disease.

:333

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these would form first during the development of a complex multicellular organism, such as an animal? A) cell B) organ
    7·2 answers
  • The nurse provides care for a client who sustained a fractured right femur. the client has a cast applied. which type of exercis
    13·1 answer
  • Which sentence best describes the role carbon plays in the structure of compounds present in living things?
    15·1 answer
  • What's does the cloaca leads on a frog ?
    7·1 answer
  • Explain what asexual reproduction is and list the 5 different types that exist.
    7·1 answer
  • What are two adaptations that a cactus has developed in order to survive in its environment.
    5·2 answers
  • Consider a protein that is made in the rough endoplasmic reticulum. You observe that when the synthesis of the protein is comple
    6·1 answer
  • What is the source of continuous heat and energy that we receive from the sun? Fill in the blank please
    15·1 answer
  • Identify whether this describes heat or temperature.<br> Symbol for the unit of measurement: C
    8·1 answer
  • In the white ovals on the map, sraw the directions and path of the winds that occur at those locations on Earth.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!