Answer: the answer is B
Explanation: Yellow bone marrow is involved in the storage of fats. The fats in yellow bone marrow are stored in cells called adipocytes.
The mutation<span> caused by the addition of a nucleotide to an already existing gene sequence is duplication.</span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Hemoglobin SS and sickle beta zero thalassemia are the most severe forms of sickle-cell disease and are sometimes referred to as sickle cell anemia. Hemoglobin SC disease is considered moderate and in general, sickle beta plus thalassemia is the mildest form of sickle-cell disease.
:333