1 Na podstawie opisu rozpoznaj elementy morfotyczne krwi i podaj ich nazwę.

During the luteal phase of the ovarian cycle, progesterone secretion peaks and estrogen levels decrease. along with these change

Radda [10]

<span>During the luteal phase of the ovarian cycle, progesterone secretion peaks and estrogen levels decrease. along with these changes, there is a corresponding increase in a woman's basal body temperature. In this phenomenon, i</span>t is not the increase in progesterone, but the decrease in estrogen that may signal an increase in overall body temperature. This is because the decrease in estrogen reduces the negative feedback signal to the hypothalamus, the thermoregulator for the body. The result is an increase in overall basal body temperature.

4 0

2 years ago

Which structure is common to plant and animal cells? 48) ______a) chloroplast

Lelechka [254]

<span> The answer is <span>centriole</span>

The majority of cells have mitochondrion as they need them for their respiration. Chloroplast is the structure plants use to produce their organic matter, the vacuole is very developed in plant cells and is central where as you usually have many vacuoles in animal cells, and the centriole is usually present in animal cells only as well as the wall of cellulose that wraps up the plant cell.</span>

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

PLEASE ANSWER FAST I'M GIVING 40 POINTS!!!

WINSTONCH [101]

The answer would be Sprots Medicine

6 0

3 years ago

Cual es la diferencia entre gemelos y mellizos

ivanzaharov [21]

Answer:

Los gemelos fraternos son "dicigóticos", lo que significa que se desarrollaron a partir de dos óvulos diferentes fertilizados por dos espermatozoides diferentes, mientras que los gemelos idénticos son "monocigóticos", es decir, se desarrollaron a partir de un solo óvulo fertilizado que se dividió.

Explanation:

4 0

3 years ago