Adaptation gives an organism the ability to survive in a particular location.
<h3>What is adaptation?</h3>
Adaption is the ability of an individual or organism to live and survive in an environment.
There is competition in the environment but the ability an individual to survive despite the competition is adaptability.
Therefore, Adaptation gives an organism the ability to survive in a particular location.
Learn more on adaptation here,
brainly.com/question/29594
#SPJ1
Answer:
The more neurons involved, the more powerful the contraction
Explanation:
The motor unit can be defined as the functional unit for muscle contraction, which consists of a motor neuron and the associated muscle fibers it innervates. The number of associated muscle fibers varies depending on the muscle’s ability for contraction. Muscles with a higher number of motor units can modulate force output more finely. The number of muscle fibers per motor unit is inversely proportional to the force that it generates, and while higher is precision, lesser is the size of the motor unit. A higher number of neurons is required for controlling motor units with lesser size, thus being greater the brain's control over the extent of shortening.
A
It increases because the biodiversity of the community in the environment during succession increases.
Explanation:
During primary succession, the nutrients in the rocks are gradually released as pioneer plants help break up the rocks into soil. These nutrients are taken up and more species of plants are able to thrive in the environment including the perennial and biennial plants. These plants provide food and shelter for higher organisms (hence many longer food webs and chains) and this is why biodiversity increases with increased succession until the climax community is reached. Increased biodiversity means increased biomass.
Learn More:
For more on ecological succession check out;
brainly.com/question/9931894
brainly.com/question/11925354
#LearnWithBrainly
Answer:
so any pollution in the water, lakes, ponds etc. will evaporate into the air and fall down as acid rain depending on the type of pollution. Acid rain can cause erosion and harm to the environment and animals. I don't get what 3 is asking but I hope this helps enough to answer it on your own.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand