Answer:
Need more information
Explanation:
Temperate: mild with normal temperatures and average rain
Tropical: lots of rain/ warm like an island (hawaii or jamaica)
Desert: hot and dry
Taiga: cold with lots of trees and mountains
<span>The red algae contain an accessory pigment called "Phycobilin"
Hope this helps!</span>
The doctor uses an EEG or also known as
Electroencephalography, this is used to record the activity of the brain,
electrically. This will help the doctor make a proper diagnosis of Ronald even
if he’s sleeping and to view what type of disorder he has with the given
results.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Living things cannot live without eachother due to the food chain, if an animal loses it's food so will his predator and so on. Soon they will end up extinct, this is why it's important to take care of animals.