1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
6

True or false: a habitat can only include one niche. ?

Biology
1 answer:
atroni [7]3 years ago
3 0
False, because a niche is how one animal uses its habitat- many animals use many different niches
You might be interested in
In humans, the allele for brown eyes is dominant to the allele for blue eyes. If a man with blue eyes and a woman with brown eye
Zarrin [17]
Hello!

The answer is 0%. I have already learned about this! :)
3 0
3 years ago
Read 2 more answers
Which statement correctly explains the polarity of the water molecule?. A) The hydrogen end of the molecule has a partial negati
vaieri [72.5K]
B I think but I am not sure hope this helps
6 0
3 years ago
Read 2 more answers
Is race a biological characteristic determined by our genes?
Harman [31]

Answer:

No, they are not. The concept of human races appears to be solidly grounded in present-day biology and our evolutionary history. But if you asked that conference of geneticists to give you a genetic definition of race, they wouldn’t be able to do it. Human races are not natural genetic groups; they are socially constructed categories. Genes certainly reflect geography, but unlike geography, human genetic differences don't fall along obvious natural boundaries that might define races.

6 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
All of the following are sources of energy for humans during exercise EXCEPTa.stored ATP.b.alcoholic fermentation.c.lacticacid f
marshall27 [118]

Answer:Letra B

Explanation:

Fementaçã alcoo

5 0
2 years ago
Other questions:
  • A weather model applies mathematical equations to
    12·1 answer
  • n a scientific experiment, the factor that may change in response to the manipulated variable is called the ______ variable.
    13·2 answers
  • What is the main role of a hormone?
    11·1 answer
  • You notice the line of mercury in your barometer is all the way to the top—30 inches. Is this high or low pressure? What kind of
    6·2 answers
  • Reproduction between two different species to create a new one.
    6·1 answer
  • Can anyone tell me what a energy pyramid is
    6·1 answer
  • I didnt mean to write this question<br>/:
    12·1 answer
  • How are fossil fuels used in the harvesting of fresh apples from an apple tree?
    12·2 answers
  • 2. What features of apples do breeders consider when growing apples?
    11·1 answer
  • PLEASE HELP<br> WILL MARK BRAINLIEST
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!