1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Drupady [299]
3 years ago
5

Leo has been learning about wind, douds, temperature, and precipitation in school. What is the name for the long-term temperatur

e, wind,
clouds, and precipitation patterns in an area?
A weather
B condensation
C climate D air masses​
Biology
2 answers:
Tems11 [23]3 years ago
4 0

Answer:

C- Climate

Explanation:

Climate is those patterns over a long period of time.

V125BC [204]3 years ago
3 0

Answer:

C. climate

Explanation:

Climate is the average weather pattern of an area over a long period of time, including its temperature, wind, clouds, and precipitation patterns.

You might be interested in
Which of the following speak a language?<br><br> A. chimps<br> B. bees<br> C. humans<br> D. dolphins
kykrilka [37]
The correct answer is C. humans

Language is an advanced system for communication available only to humans. Dolphins, chimps, and bees, use other means to communicate, but it is not a language, it's mostly things like smells or pheromones or similar things.
6 0
3 years ago
Which of the following blood vessels uses elasticity to push blood further along the bloodstream?
PolarNik [594]
The answer is Arteries 

Arteries carry oxygen-rich blood from the heart to capillaries. On the contrary, veins carry blood without oxygen from the capillaries to the heart. 
Arteries are very flexible and yet strong blood vessels so that efficient transport of oxygen-rich blood along the bloodstream through the organism is enabled.
5 0
3 years ago
Read 2 more answers
Which student’s measurement is more accurate? Why?
Anastaziya [24]

Answer:

Student B

Explanation:

They used to units of measurement to verify there answer.

Fist student rounded so its an estimate of the answer but second student verified with millimetes and cm.

Also its physics lol or maybe math.

8 0
2 years ago
Read 2 more answers
How is DNA organized in a human cell?
drek231 [11]

Answer:

Humans have nearly 30,000 genes that determine traits from eye color to risk for hereditary diseases. Those genes sit along six feet of DNA, which are organized into chromosomes and stuffed into each and every human cell. Chromosomes are coiled into loops and then organized into many large domains called topologically associating domains (TADs).

Explanation:

4 0
3 years ago
Mention the name of four groups of important pathogenic E. coli? Can TBX medium be used to recover all types of nonpathogenic an
Law Incorporation [45]

The four groups of pathogenic E.coli are enteropathogenic, enterotoxigenic, verocytotoxigenic and enteroinvasive groups. These groups can best be isolated and recoved through luria broth.

<h3>What is Escherichia coli?</h3>

The pathogenic E. coli or Escherichia coli serotypes are grouped on the basis of their mechanism of causing symptoms in humans. The six groups of pathogenic E.coli are enteropathogenic, enterotoxigenic, verocytotoxigenic, enteroinvasive, enteroaggregative and diffusely adherent E. coli.

Luria broth (LB) is one of the most commonly used growth medium for E. coli. It promotes fast growth of the organism and also provides good plasmid yields, making it an excellent choice for most laboratory applications, especially the small-scale plasmid preps.

Learn more about E.coli here:

brainly.com/question/13553402

#SPJ1

5 0
1 year ago
Other questions:
  • What do lunar and solar eclipses have in common ?
    6·1 answer
  • The stem of a plant grows_________from the pith. outwards or inwards
    13·1 answer
  • Which of the following is an advantage of biomass as an energy source?
    10·1 answer
  • Sexual reproduction can be divided into two different types based on
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is happening in these images?
    15·1 answer
  • Which of the following are missing from the food web shown above?
    8·2 answers
  • How much faster are we pumping the Ogallala Aquifer than it can replenish?
    10·1 answer
  • The nature of scientific investigation
    9·1 answer
  • in a phylogeny, information about relatedness is portrayed by the pattern of branching, not by the order of taxa at the tips of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!