1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arlik [135]
3 years ago
8

What is the function of the chloroplasts?

Biology
2 answers:
BigorU [14]3 years ago
8 0

Answer:

The chloroplast is an organelle found in cells of plant leaves. It plays an important function in photosynthesis. The chloroplast contains a pigment called as chlorophyll. This pigment is responsible for trapping light energy from sun, which is required for the process of photosynthesis.The light energy from sun is converted into chemical energy in the form of carbohydrates in the chloroplast.

Greeley [361]3 years ago
4 0
<span>work to convert light energy of the Sun into sugars that can be used by cells</span>
You might be interested in
Help thank you please
Aleksandr-060686 [28]

Answer:

It's C

Explanation:

4 0
3 years ago
Read 2 more answers
The Sun is the primary source of energy that drives all the biogeochemical cycles on Earth. Which statement best describes how t
Lyrx [107]
It should be 3! That is the only logical answer to the question...
3 0
3 years ago
Read 2 more answers
Which plant cells are involved in transporting water and minerals
Oliga [24]

Answer:

Xylem,phloem and tissues from vascular systems produce stem

Xylem + phloem+ tissues from vascular systems = stem ( transport systems)

6 0
3 years ago
The narrowest taxon in the Linnaean system is the genus, order, or species
KonstantinChe [14]
Im pretty sure its the genus
6 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Balanus is inferior to chthamalus in competing for space on rocks lower in the intertidal zone.
    11·1 answer
  • Reptiles have a special egg that feeds their young called a(n)?
    7·1 answer
  • Decomposers break down dead plant and animal materials. What happens next?
    11·2 answers
  • What is a solenoid i need helpppppp!!!!!!!!
    8·2 answers
  • I need help please I need to run this out so if you could please help that would be great.<br> .
    10·1 answer
  • HELP ASAP
    14·2 answers
  • Molecular biology of the cell​
    9·1 answer
  • White blood cells,part of the____ system,work closely with the ____system to protect us from infection and disease
    5·1 answer
  • 2. True or false: a polio virus needs a host cell to replicate *
    7·1 answer
  • Help pretty pls
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!