1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
7

2) Which of the Oceans is THE SMALLEST?

Biology
2 answers:
Aleksandr [31]3 years ago
7 0

Answer:

The arctic ocean

Explanation:

STatiana [176]3 years ago
5 0

Answer:

Arctic Ocean

Explanation:

You might be interested in
ammals that live in the Arctic Ocean have a large amount of blubber, which is a fatty tissue just beneath the skin. Which statem
frosja888 [35]
The arctic environment is deathly cold, hence the thick blubber on animals so they can handle freezing temperatures
4 0
3 years ago
Which of the following is a cause of a DNA mutation?
Reika [66]
DNA Mutation is caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes. Thus, the correct answer is option D.

1.DNA Mutations are caused by environmental factors known as mutagens.

2.Types of DNA mutagens include radiation, chemicals, and infectious agents.

3.DNA Mutations may be spontaneous in nature.
7 0
2 years ago
The excretory system helps the respiratory system by
Leto [7]

Answer:

The excretory system helps the respiratory system by removing carbon dioxide that is produced during respiration (third option).

Explanation:

The lungs are in charge of the breathing process, being the main organ of the respiratory system. Each lung is considered an excretory organ —belonging to the excretory system— since it is capable of eliminating the carbon dioxide (CO₂) produced by the metabolism during expiration.

As a result of the gaseous exchange, the oxygen entering the lungs through the inhaled air passes into the blood, while the CO₂ is removed from the blood. This CO₂ is removed during expiration, which makes the lungs part of the excretory system.

The other options are not correct because:

  • <em>The excretory system does </em><u><em>not introduce more oxygen into the lungs</em></u><em>. </em>
  • <em>The </em><u><em>circulation of blood in and out of the lungs</em></u><em> is a function of the circulatory system. </em>
  • <u><em>Urine is not produced by breathing</em></u><em>.</em>
6 0
3 years ago
Read 2 more answers
Which part of the root allows it to grow deep inside the soil in search of water? A. epidermis B. cortex C. root tip
Zepler [3.9K]
The root tip allows the plant to grow deeper into the soil
3 0
3 years ago
How can you tell that matter is conserved in this reaction?
Leona [35]
You can tell if matter is conserved if the substance changes . If the substance changes then matter has been conserved .
8 0
3 years ago
Other questions:
  • What are the steps of evaporated water through the water cycle
    10·1 answer
  • Witch two cellular structures have a role in the creation of proteins
    14·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What happens during the experiment stage of the scientific method
    9·1 answer
  • Put the 5 objects in space by order in size : planet,star,moon,galaxy,solar system
    14·1 answer
  • Three young children are fighting over where to take
    14·1 answer
  • What can you observe with the cartoon? What is your own interpretation of it?​
    15·2 answers
  • Which of the following statements is true for asexual reproduction?
    5·1 answer
  • List body external and internal defenses
    11·1 answer
  • 12. A farmer is struggling to control the population of a certain insect on his farm. After researching population control techn
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!