1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UkoKoshka [18]
3 years ago
15

The position of an element on the periodic table helps scientist predict the

Biology
1 answer:
larisa [96]3 years ago
8 0
First, we need to look at which elements gain two electrons to form an ion. These are the ones in the 16th group. The most reactive non-metals (aka most likely to for ions) are closer to the top of the periodic table as they have less shells. Therefore, the answer to your question is oxygen
You might be interested in
What is difference between nervous and chemical(endocrine) system???
Citrus2011 [14]

Answer:

Endocrine system uses chemical signaling (hormones produced by glands) while the nervous system uses electrical signaling (neural impulses).

6 0
3 years ago
Read 2 more answers
Necie hypothesizes that the temperature at which an alligator's egg is incubated influences whether the hatching alligator will
STALIN [3.7K]

Answer: b: the sex of the hatching alligator.

Explanation: what the temperature is altering is the sex of the alligator.

please give this brainliest if it helped! :}

6 0
3 years ago
Earths orbit is called what
kati45 [8]
Earths rotation ......
6 0
3 years ago
Joshua is holding a book near shoulder-height. Use the drop-down menus to indicate what happens to the gravitational potential e
fredd [130]

Answer:

Increases

Stays the same

Decreases

Explanation:

I took the test

4 0
3 years ago
Read 2 more answers
Es un combustible fosil utilizado frecuentemente en las hornallas de nuestras cocinas para calentar los alimentos
Daniel [21]

Answer:

Gas natural

Explanation:

5 0
3 years ago
Other questions:
  • Explain why a law is accepted as fact, but a theory is not.
    11·2 answers
  • Which of the following is a true difference between prokaryotic and eukaryotic cells?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • According to most scientific models, how many years ago did the first simple cells appear on Earth?
    7·1 answer
  • You have found a new prokaryote. What line of evidence would support your hypothesis that the organism is a cyanobacterium? You
    6·1 answer
  • The and are part of the digestive system
    6·2 answers
  • Emma is having a tea party with her stuffed animals and dolls, and pretends that they love the tea and cookies she prepared. Emm
    9·1 answer
  • Use the following dichotomous key to identify an irregular blue flower with five petals and a fruit that is a ripened flower ova
    6·1 answer
  • Which type of anatomical structure is the appendix
    6·1 answer
  • Which of the following are mainly cycled through the processes of photosynthesis and cellular respiration?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!