Explanation:
i didnt pay attention last year soooo sorry
The answer is;
a. add electric current.
b. add buffer solution
The process of gel electrophoresis taps on the property of net charges of molecules to ensure that they travel up the gel. Additionally, the buffer acts as the mobile phase for the molecules and also give molecules net charge as they travel through the gel. It is until the molecules reaches an isoelectric point,where the molecule has zero net charge, that they stops moving through the gel. This is how bands are formed.
Answer: Kidney
Explanation: The Kidneys produce the hormone in response to cellular hypoxia due to loss of blood.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
