1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
2 years ago
13

The induced fit model of enzyme action fine tunes the original concept of the lock and key model and modifies it. This induced f

it model changes the original
Hypothesizing that
Biology
1 answer:
kipiarov [429]2 years ago
4 0
Your correct my dear, very good answer
You might be interested in
Ceruminous glands are ________. Ceruminous glands are ________. saliva glands found at the base of the tongue modified taste bud
kogti [31]

Answer:

Modified apocrine sweat glands

Explanation:

The ceruminous glands are similar to sebaceous glands, belonging to the group of sweat glands. These glands secrete a sticky material, the ear wax, that protects the thin skin lining the ear canal.

As soon as a dust, dirt or an insect enters the ear canal at the beginning of the ear wax, the wax retains, wraps and pushes it outside the ear canal.

This secretion is lubricating as well as acidic, which helps to kill potentially harmful bacteria and fungi in the ears.

5 0
2 years ago
Rachel wants to test how sunlight impacts plant growth over time she will add billing amount of light to different sets of plans
ahrayia [7]

Answer: sunlight.

Explanation: When trying to establish the level or extent of correlation or relationship which exists between two variables, the variables are classed as independent and dependent variables. The independent variable is referred to as the variable which causes a change in the value of the other variable (dependent variable). It is also known as the explanatory or predictor variable as it lead to changes in the dependent or predicted variable. In the scenario above, the independent variable is sunlight whose impact leads to changes in the growth level of the plant.

6 0
3 years ago
Compare and contrast populations and communities
zloy xaker [14]
A population is essentially just a collection of all living things in one category. People are one population, insects are another, etc. Communities are "more organized" populations. Soccer players hang out with soccer players, spiders hang out with spiders. We split into "our people" within our population. 

I know that may be a little confusing, but if you have anymore questions feel free to ask. I hope I was able to help. Best of luck!
7 0
2 years ago
Fill blanks with:N−Cα−C N − C α − CCα−C C α − CN−Cα N − C αbackboneside chaina stable secondary structurea stable tertiary struc
polet [3.4K]

Answer:

Explanation: see attachment below

3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Other questions:
  • Please help ASAP!!!!!!!!!!
    5·2 answers
  • Explain the importance of enzymes to living organisms?
    12·1 answer
  • A puggle is a type of dog first produced by mating two other types of dog a pug and a beagle what is that process
    9·1 answer
  • Which of the following are involved in RNA translation? I. mRNA II. tRNA III. ribosomes IV. amino acids
    7·1 answer
  • For some Gram-negative bacterial infections, antibiotic treatment can cause a more severe reaction than that caused by the base
    14·1 answer
  • pzzzzzzzzzzzzzzzzz help me !!!! The blood sugar in your body is maintained by a gland that acts as an exocrine and endocrine gla
    10·2 answers
  • The great ocean conveyer belt explains how cold the dence water curiculates ypwellinf occurs sun light surface water and then th
    7·1 answer
  • What is the first mammal to walk on earth?
    8·1 answer
  • An insect that has evolved to resemble a plant twig will probably be able to avoid A) parasitism. B) symbiosis. C) predation. D)
    6·1 answer
  • Is it easier to restore damaged land and soil than it is to protect true or false
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!