Answer:
The correct answer is "Transgenics".
Explanation:
The missing options of this question are:
A. Artificial selection
B. Transgenics
C. Bioreaction
D. Recombination
The correct answer is option B. "Transgenics"
Transgenics is a term used to describe the artificial insertion of one or more DNA sequences to an organism that would normally not have it. In this example, the term transgenics applies to the cows that serve as hosts for the production of the spider silk. The process transgenics is what gives the name to terms such as "transgenic food", "transgenic plants" or "transgenic animals".
The mitochondria is the powerhouse, or in a sense the brain of the cell. The plant would be unable to (a) carry out respiration
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer:
Scientists use a system like this to group living things. the grouping are based on common traits. this system helps scientists to study the million of organisms of new organisms are discovred each year
This is your answer...
plz... thanks me
