1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ymorist [56]
3 years ago
12

Which of the following is the pattern of growth a human population will follow over its lifetime?

Biology
1 answer:
pantera1 [17]3 years ago
7 0
The answer is C because that’s just that
You might be interested in
When hydrogen ions are decreased, is the pH higher or<br>lower?<br>wi<br>and for​
Papessa [141]

Answer:

The overall concentration of hydrogen ions is inversely related to its pH and can be measured on the pH scale . Therefore, the more hydrogen ions present, the lower the pH; conversely, the fewer hydrogen ions, the higher the pH.

3 0
3 years ago
What is semipermeable
ANEK [815]
Semipermeable means only certain substances can pass through. I imagine you are talking about cell membranes which are semipermeable. This means vital things like oxygen and nutrients are able to pass through the membrane, while not allowing everything to enter the cell
7 0
3 years ago
Please help i’ll mark u as the brain thing !!
scZoUnD [109]

Answer:

There are many important pieces that together make up a writer's style; like tone, word choice, grammar, language, descriptive technique, and so on. Style is also what determines the mood of a piece of literature, so its importance is huge across all genres.

Explanation:

Does this help at all??

7 0
3 years ago
Where is the insertion of the sartorius?
Readme [11.4K]

Answer:

Sartorius is inserted in the tibia.

Explanation:

Sartorius muscle is orginated from the iliac spine of the pelvioc bone. This muscle is the longest muscle of the human body. This muscle runs down on the thigh's anterior compartment.

The sartorius muscle is inserted in the anteromedial surface of the proximal tibia in the pesanserius. The insertion can be shown on the upper medial  of the tibia. Femoral nerve innervates the sartorius muscle.

3 0
3 years ago
You have a rectangular block of wood measuring 4 cm long, by 3 cm wide, by 3 cm high. What is the volume of this block of wood i
soldi70 [24.7K]

Answer:

36 cm

Explanation:

4x3= 12

then,

12x3= 36 cm

4 0
3 years ago
Other questions:
  • The speed of light in four different materials is shown below:
    8·2 answers
  • How are chlorophyll and chloroplasts related, and where are they found?
    8·1 answer
  • When diet and health are adequate, __________ is largely influenced by heredity. the onset of menarche height weight the onset o
    6·2 answers
  • Which nonmetals, besides hydrogen, are most often involved in hydrogen bonding?
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • During the process of mammalian fertilization, a sperm cell encounters glycoproteins in the gelatinous extracellular matrix that
    5·1 answer
  • PLEASE HELP ME IM ON MY LAST ATTEMPT!!!!! I WILL MARK BRAINLEIST
    8·1 answer
  • Please help! Due today!
    11·1 answer
  • Plants' leaves absorb energy from __________, which often comes from the Sun. What word completes the sentence?
    12·1 answer
  • Which molecule is hydrolyzed (digested) by amylase? Multiple Choice glucose albumin starch cellulose glycogen
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!