1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnZ [28]
3 years ago
14

Sweating and panting are examples of which characteristic of life?

Biology
1 answer:
Viktor [21]3 years ago
4 0

Answer:

Responding to the environment

Explanation:

Sweating and panting are mechanisms of homeostasis i.e the regulation of the body's internal environment in response to changes or fluctuations in the external environment.

Sweating is a physiological response to the body's core temperature rising above the limit of 36.5-37.5°C. Once the hypothalamus in the brain detects this rise in temperature, cooling mechanisms are initiated. One of these is sweating. Release and subsequent evaporation of sweat through the sweat glands produces a cooling effect.

Panting is a physiological response more observed in dogs. Dogs lack sweat glands and therefore cannot lower their core temperature through sweating. Panting utilizes saliva instead of sweat to lower body's temperature to the set limit.

You might be interested in
What Are Some Bad facts About the cytoplasm
Lynna [10]
That its not in the cell or that its just there or that you can't find it anywhere else but in the body outside the cell....
4 0
3 years ago
What is the most important life form during the beginning of pedogenesis?
kicyunya [14]

Answer:

Earthworms and ants

Explanation:

Already took Biology! :D

5 0
3 years ago
Read 2 more answers
If the motion of the particles in the
melamori03 [73]

Answer:

Go down

Explanation:

Because the motion of the particle in the room stop

7 0
3 years ago
Only scientists use model true or flase
vodomira [7]
In general, Yes  True  <span />
4 0
3 years ago
Read 2 more answers
The mitochondrial inner membrane form a series of infoldings known as cristae to:
REY [17]

Answer: Increase the surface area.

Explanation:

The mitochondria is an important cell organelle that is found in both the plant cell and animal cell.

It basically aids in the production of ATP, hence also known as the power house of the cell.

The mitochondria is a double membrane system in which the inner membrane of mitochondria helps in increasing the surface area for integral proteins.

It helps in embedding the proteins in the folding known as cristae.

6 0
3 years ago
Other questions:
  • True or False : florida has been covered by glaciers in the past
    5·1 answer
  • Twind is considered to be an abiotic factor because it.?
    12·1 answer
  • Describe the motion of the continents from the cambrian period through the quaternary period
    5·2 answers
  • Crops are protected from disease-causing fungi by use of fungicides or by the use of genetically engineered fungi-resistant crop
    13·2 answers
  • Which of the following is NOT a food produced in rainforests?
    7·2 answers
  • When does cell differentiation occur?
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • BRAINLYIST PLSSSS HURRY
    5·2 answers
  • People remember a list of words better if they study and recall words in the same environment (like studying under water and rec
    7·1 answer
  • SUMMARY| CHARACTERISTICTS OF LIFE<br> lesson question: what does it mean to be living?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!