1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddik [55]
3 years ago
11

Which of the following is the best example of sensory interaction?

Biology
2 answers:
garik1379 [7]3 years ago
8 0

Answer:

Option A, Finding that despite its delicious aroma, a weird-looking meal tastes awful

Explanation:

Sensory interaction refers to the interaction between different senses and how they modulate perceiving capacity of one sense based on the  perceived information from other sense.

The interaction of the senses interfere and influence each other

For example  -  Taste and smell are two senses that work together.

Here in option A, the nose senses the aroma and the eyes look at the food texture.

Hence, option A is the best example of sensory interaction

Vilka [71]3 years ago
7 0

Answer:

I believe c not completely sur e though

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Oxygenated blood flows from the __________ to the __________ before being pumped into the systemic circulation.
jeka94

Answer: from the pulmonary veins into the left atrium.

Explanation:

After oxygenation of blood in the lungs, the right and left pulmonary veins carry oxygenated blood and empties it into the left atrium. The left atrium then empties the blood into the left ventricle through the left atrioventricular valve.

With contraction, the ventricle pumps the blood to the systemic circulation through the aorta. The blood flow into the aorta is guarded by the aortic valve.

7 0
3 years ago
Most scientific questions are based on??
kow [346]
Usally biology or chemistry
8 0
3 years ago
Read 2 more answers
What is the role of DNA in transmitting genetic information? Describe DNA’s important genetic role in a few sentences below.
Dafna1 [17]
Hey could you just mind yiu own business like sheshhhhhhhh
7 0
3 years ago
The word microcosm is made up of the prefix -micro and The root word -cosm
Leviafan [203]
A. Order, Arrangement, world and Universe
5 0
3 years ago
Other questions:
  • David was in a car accident and needed a blood transfusion due to his injuries. His brother, Steve, went to the hospital hoping
    15·1 answer
  • Matter is reused in both the water cycle and the carbon cycle.
    15·1 answer
  • Why does the actions of the thymus demonstrate a close functional connection between the lymphatic system and the endocrine syst
    15·1 answer
  • An atom of element A has 27 protons. What would the element's atomic number be?
    7·1 answer
  • How do limiting factors affect the carrying capacity of an inviroment?
    10·1 answer
  • Distinguish between magna and lava
    15·2 answers
  • The difference between quartzite and quartz is that in quartzite, the grains
    6·2 answers
  • Which of the following goals is the U.S. Integrated Ocean Observing System (OOS) not intended to address?
    5·2 answers
  • What best describes the head end of a phospholipid?
    7·1 answer
  • Most plants incorporate carbon dioxide into sugars by means of a cycle of reactions called the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!