3 years ago

Which of the following is the best example of sensory interaction?

Biology

2 answers:

garik1379 [7]3 years ago

8 0

Answer:

Option A, Finding that despite its delicious aroma, a weird-looking meal tastes awful

Explanation:

Sensory interaction refers to the interaction between different senses and how they modulate perceiving capacity of one sense based on the perceived information from other sense.

The interaction of the senses interfere and influence each other

For example - Taste and smell are two senses that work together.

Here in option A, the nose senses the aroma and the eyes look at the food texture.

Hence, option A is the best example of sensory interaction

Vilka [71]3 years ago

7 0

Answer:

I believe c not completely sur e though

Explanation:

You might be interested in

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0

3 years ago

Oxygenated blood flows from the __________ to the __________ before being pumped into the systemic circulation.

jeka94

Answer: from the pulmonary veins into the left atrium.

Explanation:

After oxygenation of blood in the lungs, the right and left pulmonary veins carry oxygenated blood and empties it into the left atrium. The left atrium then empties the blood into the left ventricle through the left atrioventricular valve.

With contraction, the ventricle pumps the blood to the systemic circulation through the aorta. The blood flow into the aorta is guarded by the aortic valve.

7 0

3 years ago

Most scientific questions are based on??

kow [346]

Usally biology or chemistry

8 0

3 years ago

Read 2 more answers

What is the role of DNA in transmitting genetic information? Describe DNA’s important genetic role in a few sentences below.

Dafna1 [17]

Hey could you just mind yiu own business like sheshhhhhhhh

7 0