1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
riadik2000 [5.3K]
4 years ago
9

"(purple smooth = 75, white smooth = 28, purple wrinkled = 24, white wrinkled = 8) Which alleles are dominant?"

Biology
2 answers:
azamat4 years ago
7 0

Answer:

The purple smooth allele

Explanation:

This is obviously due to the high phenotypic ratio of the allele plus its has the highest visible number

topjm [15]4 years ago
4 0

Answer:

<u>The alleles which cause the color to be purple and appearance to be smooth are dominant.</u>

This is a typical case of Mendelian dihybrid cross in which the ratio of the off-springs is 9:3:3:1 and the off-springs with highest output i.e. 9 are generated out of dominant alleles. So if we will compare the results mentioned in the question we can easily infer that these off-springs also have similar ratio as described above.

Explanation:

purple smooth = 75

white smooth = 28

purple wrinkled = 24

white wrinkled = 8

If we will divide purple smooth = 75 by 8 which is the output of white wrinkled, we will get 9.4 as answer which is ~9.

If we will divide white smooth = 28 by 8 which is the output of white wrinkled, we will get 3.5 as answer which is ~3.

If we will divide purple wrinkled = 24 by 8 which is the output of white wrinkled, we will get 3 as answer.

Hence, the ratio of purple smooth : white smooth : purple wrinkled : white wrinkled = 9:3:3:1.

You might be interested in
When do sexually reproducing organisms do meiosis?
spayn [35]

Answer:

Explanation:

In the male, meiosis takes place after puberty. Diploid cells within the testes undergo meiosis to produce haploid sperm cells with 23 chromosomes. A single diploid cell yields four haploid sperm cells through meiosis. In females, meiosis begins during the fetal stage when a series of diploid cells enter meiosis I.

6 0
3 years ago
If two objects of the same size will always have the same mass?
8090 [49]
This is incorrect. Size and mass are not related. An example, a balloon that is filled with air can be compared to a bunch of iron that is of the same size yet it has much a smaller mass than the lump of iron.
5 0
4 years ago
If the aorta of the heart is damaged, which function of the heart will be affected first?
xz_007 [3.2K]

The right answer is supplying oxygenated blood to the arteries that travel to all major body parts

Aorta is the principal artery of the body.

It starts from the left ventricle of the heart, passes through the thorax and abdomen to separate at the lower part of the abdomen, into two branches called common iliac arteries for the lower limbs. We talk about thoracic aorta then abdominal aorta along its path in relation to the anatomical position. All arteries in the body (carrying oxygenated blood) are directly or indirectly derived from the aorta except the pulmonary artery.

3 0
4 years ago
Read 2 more answers
How do you following accurately pairs a type of receptor to the stimuli in which a responds?
Sholpan [36]
<span> <span><span> <span> <span>  <span>A. </span>Mechanoreceptor–temperature </span> </span> </span> <span> <span> <span>  <span>B. </span>Photoreceptor–chemicals </span> </span> </span> <span> <span> <span>  C. Pain receptor–tissue injury </span> </span> </span> <span> <span> <span>  <span>D. </span>Chemoreceptor–pressure </span> </span> </span> </span></span>




8 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Other questions:
  • What would happen to the size of the carnivore population if the herbivore population increased?
    9·1 answer
  • What are the benefits of being vaccinated against certain diseases?
    11·1 answer
  • Choose all the answers that apply. What are examples of how science has influenced technology? A. discovery of x-rays allowed fo
    13·2 answers
  • When reviewing the history of a patient who will be taking an antifungal drug?
    15·1 answer
  • Which three terms relate to sexual reproduction but not asexual reproduction
    11·2 answers
  • The diagram below shows the structure of a protein. what is the structure labeled A
    9·1 answer
  • The movement of water through a semi-permeable membrane is called?
    10·2 answers
  • Many farmers and gardeners compost their plant and animal waste. The living material naturally decays in compost bins, forming a
    7·1 answer
  • Enzymes are catalysts in reactions. what statements describe functions of enzymes?
    7·1 answer
  • Which class of chemical messenger facilitates white blood cell formation in bone marrow?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!