Answer: The percentage would be 19%, 51% and 30%.
Explanation:
Since we have given that
Number of food eaten by X = 57
Number of food eaten by Y = 153
Number of food eaten by Z = 90
Total number of food eaten = 
So, Food percentage of flock X = 
Food percentage of flock Y = 
Food percentage of flock Z = 
Hence, the percentage would be 19%, 51% and 30%.
Answer: False.
Genetic drift is a stochastic process that occurs randomly through time. It refers to random fluctuations in allele frequencies due to chance events (small population size).
Explanation: Factors that can affect genetic diversity are Genetic drift, mutation, selection, migration, non-random mating and recombination.
Of these factors, forces that majorly control the fate of genetic variation in populations are genetic drift and natural selection.
Genetic drift refers to random fluctuations in allele frequencies due to chance events (small population size).
Natural selection involves environmental conditions acting on wild plant or animal populations or species. Most fit in a selection refers to genotype or phenotype with greater average reproductive output over it's lifespan than other genotypes or phenotypes.
A fault that is formed when compression causes the hanging wall to move over the foot wall is known as a Reverse Fault. The Reverse Fault is going to be the opposite of what the normal fault is. The normal fault usually occurs in the region/area that is undergoing the compression.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
