1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex_Xolod [135]
3 years ago
10

How are proteins built using the information provided by a molecule of RNA?

Biology
2 answers:
bonufazy [111]3 years ago
7 0
<span>a mRNA translates a dna to rna and goes to a ribosome a tRNA reads it and attaches it to a rRNA to make a protein</span>
anastassius [24]3 years ago
7 0

Answer:

The RNA helps in the determination of the sequence of amino acids in proteins and polypeptides by a two-step procedure, that is, the transcription of DNA, which generates mRNA in the nucleus, and the translation of the mRNA to tRNA occurring at the ribosome in the cytoplasm.  

The association of ribosomal RNA takes place with a set of proteins to produce ribosomes. These composite structures move physically along the molecule of mRNA and catalyze the arrangement of amino acids into protein chains. They also associate with tRNAs and different other accessory molecules that play an essential role in the synthesis of protein.  

You might be interested in
Trilobites are extinct marine invertebrates. Scientists found a trilobite fossil in
Kay [80]
The correct answer is D.
6 0
3 years ago
The depth of a lake is most likely to be measured in
labwork [276]
That depends on where you are in the world. Due to the fact that America is the ONLY nation in the world who uses the ft/in system, it would most likely be measured in meters. 
7 0
4 years ago
What is the powerhouse of the animal cell
pochemuha
Mitochondria is the powerhouse of the animal cell
6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
NEED HELP PLZZ ASAP
Oksanka [162]

Answer:

Make sure everyone meets criteria.

Not taking supplements( As some may contain Vit D)

No tanning beds

make sure no one has a hypoactive response to vitamin d through whatever way. Injection, capsule, spray.

Check for genetic conditions or cancers like melanoma which indirectly affect vitamin d levels

Explanation:

These are some of the main things to look out for

8 0
3 years ago
Other questions:
  • ATP is thermodynamically suited as a carrier of phosphoryl groups in animal cells because of all EXCEPT ________.
    14·1 answer
  • What kind of intermolecular bonds exist between water molecules?
    13·1 answer
  • Homeostasis depends on the activity of body systems to adjust a variable. Because our bodies work so well to maintain variables
    9·1 answer
  • Which of the following is TRUE?
    9·1 answer
  • Which major environmental factors can affect health?
    7·2 answers
  • Most rain Falls where on earth
    8·1 answer
  • Normal cells die in a nutrient medium containing thymidine and methotrexate, whereas mutant cells defective in thymidylate synth
    12·1 answer
  • What is a photosytem
    9·1 answer
  • What is the correct sequence of steps in the cell cycle?
    9·1 answer
  • Which of the following is not a potential consequence of Earth reaching its global capacity?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!