Answer: One H⁺ ion ie required in converting ATP and inorganic phosphate to ATP
Explanation:During oxidative phosphorylation, high energy electrons released by hydrogen carriers are shuttled through the electron transport chain. The released energy is used to translocate 3 H+ ions from the matrix, creating an proton motive force, which will cause 1 H+ ion to move down the electrochemical gradient and diffuse back into the matrix (chemiosmosis) which is facilitated by ATP synthase. As the H+ moves through the ATP synthase this triggers the molecular rotation of the enzyme, synthesizing ATP
Limestone is essential for the formation of petroleum reservoirs
Limestone is great for soil as due to its structure, it can buffer acidic chemicals in soil
It is useful in the prevention of explosions from mining that are caused from too much methane release
It is useful in mediating the effects of erosion the the environment
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The correct answer is D. Abstinence
Explanation:
A contraceptive method or birth control method refers to a method used to avoid pregnancy or reduce the probability of getting pregnant. From antiquity, there have been different contraceptive methods but only in the last decades, methods have been designed based on science and its effectiveness has been studied.
Because of this, nowadays there are many contraceptive methods such as pills, condom, and implants that are about 80% to 95% effective, sterilization that is a around 98% effective and natural methods that have a lower percentage of effectiveness. But the only method that has been proven as completely effective or 100% effective is abstinence because by avoiding any type of sexual intercourse it is virtually impossible an egg can be fertilized by a spermatozoid.
Answer:
Protein synthesis is the process which synthesizes proteins by the information coded in the DNA molecule with the help of two distinct process takes place in order namely transcription and translation.
Transcription is the first process of the central dogma or the protein synthesis that produces mRNA molecule that carries all the information stored in the DNA molecule out of the nucleus (in eukaryotes only) to the ribosome where the second process Translation takes place.
Untwists then unzips of DNA molecule is catalyzed by RNA polymerase result in the Hydrogen-bonds between the strands break
.
Creates complementary base pairs with bases of the DNA strand with help of free RNA nucleotides
weak hydrogen bonds and sugar-phosphate bonds form between base pairs and RNA nucleotides respectively
mRNA strand is synthesized and peels off the DNA and transported or pass from the nucleus to cytoplasm
