1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
9

Without genetic variation, the mechanisms of evolutionary change will not occur. There are several sources of genetic variation

Biology
1 answer:
MissTica3 years ago
6 0

Answer: A, B, and D

Explanation: I just took the test

You might be interested in
Practicing three-point shots to improve free-throw accuracy contradicts the _________ principle of exercise.
vodomira [7]
Practicing three point shots to improve free throw accuracy contradicts the SPECIFICITY principle of exercise.
The specificity principle of exercise states that, to become an expert in a particular exercise or skill one should perform that exercise or skill. That is, the things that one do during physical activity should be relevant to one desired outcomes, thus, the training regimen must go from general to specific during training.
5 0
3 years ago
Read 2 more answers
What is the name of the structure that composers most of the cell membrane?
noname [10]

The cell membrane consists of three classes of amphipathic lipids: phospholipids, glycolipids, and sterols. The amount of each depends upon the type of cell, but in the majority of cases phospholipids are the most abundant, often contributing for over 50% of all lipids in plasma membranes.

6 0
3 years ago
Read 2 more answers
No cell wall, round/irregular shape, one or more small vacuoles, centriole, no chloroplasts, cytoplasm, ER, ribosomes, mitochond
miskamm [114]

Answer:

an animal cell

Explanation:

all of these characteristics define an animal cell

7 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Every organism has a unique ecosystem in which it lives. This ecosystem is its natural habitat. This is where the basic needs of
astraxan [27]

Animals dont need to breed to survive for themselves, but they do need food, water and shelter

is that whats being asked? this is a bit confusing

4 0
3 years ago
Other questions:
  • If, after extensive research, the expected observations predicted by a theory fail to materialize, then the theory _____.
    12·1 answer
  • Which terms describe the different movements of Earth? Select three options.
    10·2 answers
  • Explain how the color of the moth increases or decreases their chances of survival.
    5·1 answer
  • Which process can affect the rate of carbon dioxide emissions or other greenhouse gas emissions by changing average temperatures
    7·1 answer
  • Is glycerol an atom?
    15·1 answer
  • Which human activity has affected the nitrogen cycle? i. use of fertilizers ii. combustion of fossil fuels iii. deforestation?
    11·1 answer
  • Which cell division is pictured?
    14·1 answer
  • What is the purpose of vaccines?
    5·2 answers
  • Which of the following muscles does NOT flex the wrist?
    9·2 answers
  • What measurements can be used to determine how colors of light affect plant growth
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!