1. The tree can grow to over<span> 100 </span>feet tall
<span>2. </span>Reproduction happens when the fruit of the tree ripen and burst open<span>, </span>leaving seeds scatteredin a<span> 100 </span>foot
<span>3. </span>The leaves of the Rubber Tree are glossy<span>, </span>oval shaped and dark green<span>. </span>They can grow to be<span> 14 </span>inches
<span>4. </span>It is a quickly growing tree<span>, </span>as are most trees in the (related to areas near the Equator/hot and humid) rainforest<span>, </span>it can grow<span> 24 </span>inches
<span>5. </span>The Rubber tree grows best in bright sunlight or filtered sun and although it is best suited for the wet and hot <span>climate</span>
Answer #1: instinctual trait
Answer#2: learned trait
Answer:
Both gene expression and DNA micro array study about the expression of gene during different stages of development.
Explanation:
The main purpose of gene expression studies is to determine the level of mRNA expressed at different stages of transcription in a tissue or at different stages of cellular development. If a gene is not “ON” during synthesis of RNA and protein, then the desired proteins are not produced. Such studies allow us to turn on such genes.
DNA microarray assays easily identify and determine the network of gene expression across the entire genome. The common application of DNA microarray include – mutation analysis and detection, assessment of gene cop, immunoassays etc.
The correct answer is option 3, that is, lysosome.
The lysosomes comprise hydrolytic enzymes essential for intracellular digestion. They are commonly found in the cells of animals but are rare in plant cells. In the plant cells, the hydrolytic enzymes are most often found in the vacuoles.
The other mentioned components like cell wall are exclusively found in plant cells, not in animal cells, vacuole is found in both plant and animal cells, it is bigger in plant cells in comparison to animal cells, and the mitochondria are witnessed in both plant and animal cells.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
