1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kamila [148]
3 years ago
15

Which statement is a hypothesis? Jada decides to investigate the effectiveness of hand sanitizers compared to soap. She says tha

t hand sanitizers are as effective as soap in destroying bacteria. Many sanitizers have alcohol as their main component. She performs a study in which people use sanitizers for one week and then soap for another week. She then examines the bacterial count.​
Biology
2 answers:
yulyashka [42]3 years ago
8 0

Answer:

Hand sanitizers are as effective as soap in destroying bacteria.

Explanation:

A hypothesis is a supposition that is made with limited evidence. Jada is performing this experiment to provide further evidence either supporting or rejecting her theory of whether hand sanitizers are as effective as soap.

iren [92.7K]3 years ago
3 0
Answer:

She says that hand sanitizers are as effective as soap in destroying bacteria.

Explanation:
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How does salt-induced land degradation occur?<br> NEED ASAP<br> WILL MARK BRAINLIEST
yulyashka [42]

Answer:

Salt-induced land degradation occurs in regions where there rainfall is too low to maintain of water to go into the soil.

Explanation:

Tell me if I'm right pls

3 0
3 years ago
What important changes occur in the nucleus and the cell during the longest phase of the cell cycle?
sp2606 [1]
The longest phase of mitosis is prophase. Because the nuclear membrane disappears, Nucleolus disintegrates, and the DNA condensed to form chromosomes (each chromosome is composed of sister chromatids attached around centromere.)
5 0
3 years ago
Someone please help me with this I really need to pass this test!!!!
mafiozo [28]

The conductor is similar to the nucleus of the cell. Like how the conductor controls the train, the nucleus controls and regulates cell activity.

8 0
3 years ago
Why must a ecologist consider both speciation and extinction when analyzing
Feliz [49]

Answer:

An ecologist must consider both of the speciation and extinction of an organism or when analyzing the diversity the life on earth because of the following reasons;

-          It is a role of an ecologist

-          It is part of their job

-          This will tell the existence of the organism

-          The organism’s life span on earth

-          How it was existed and were extinct

Explanation:

7 0
3 years ago
Other questions:
  • Which parts of the worm are included in the excretory system?
    13·1 answer
  • What are high air pressure systems usually associated with?
    5·2 answers
  • What is overproduction?
    14·2 answers
  • I NEED HELP ASAP (WILL MARK BRAINLIEST IF ITS THE RIGHT ANSWER) which of the following describes asexual reproduction
    9·2 answers
  • What is combustion and how does ir affect the carbon cycle?
    6·1 answer
  • The ETS reactions produce ATP from ADP using the energy provided by which two molecules?
    10·2 answers
  • What do scientists do
    12·2 answers
  • Based on thomsons plum pudding model of the atom what did rutherford expect to happen
    8·1 answer
  • What is the purpose of genetically modified crops?
    13·1 answer
  • Which part of cellular respiration provides most of the energy for cheetahs to run?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!